ID: 1152594464

View in Genome Browser
Species Human (GRCh38)
Location 17:81231691-81231713
Sequence ACCCGGCCATTCCCCCTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594464_1152594476 22 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594476 17:81231736-81231758 CCCCACTCCTGTCTCGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 144
1152594464_1152594472 20 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594464_1152594478 23 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594478 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1152594464_1152594469 -7 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594464_1152594474 21 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG 0: 1
1: 0
2: 1
3: 9
4: 144
1152594464_1152594468 -10 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594464 Original CRISPR ACCCGGCCATTCCCCCTGGC AGG (reversed) Exonic