ID: 1152594465

View in Genome Browser
Species Human (GRCh38)
Location 17:81231695-81231717
Sequence CTTGACCCGGCCATTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594465_1152594476 18 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594476 17:81231736-81231758 CCCCACTCCTGTCTCGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 144
1152594465_1152594481 28 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594481 17:81231746-81231768 GTCTCGCATGGGGGAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75
1152594465_1152594478 19 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594478 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1152594465_1152594472 16 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594465_1152594474 17 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG 0: 1
1: 0
2: 1
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594465 Original CRISPR CTTGACCCGGCCATTCCCCC TGG (reversed) Intronic