ID: 1152594466

View in Genome Browser
Species Human (GRCh38)
Location 17:81231696-81231718
Sequence CAGGGGGAATGGCCGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594452_1152594466 16 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
1152594458_1152594466 -8 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
1152594449_1152594466 28 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
1152594454_1152594466 -5 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594466 Original CRISPR CAGGGGGAATGGCCGGGTCA AGG Intronic