ID: 1152594467

View in Genome Browser
Species Human (GRCh38)
Location 17:81231697-81231719
Sequence AGGGGGAATGGCCGGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594458_1152594467 -7 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594459_1152594467 -10 Left 1152594459 17:81231684-81231706 CCTCGACCCTGCCAGGGGGAATG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594452_1152594467 17 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594454_1152594467 -4 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594449_1152594467 29 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594467 Original CRISPR AGGGGGAATGGCCGGGTCAA GGG Intronic