ID: 1152594468

View in Genome Browser
Species Human (GRCh38)
Location 17:81231704-81231726
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594462_1152594468 -9 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594458_1152594468 0 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594464_1152594468 -10 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594454_1152594468 3 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594459_1152594468 -3 Left 1152594459 17:81231684-81231706 CCTCGACCCTGCCAGGGGGAATG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594452_1152594468 24 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type