ID: 1152594469

View in Genome Browser
Species Human (GRCh38)
Location 17:81231707-81231729
Sequence GCCGGGTCAAGGGTGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594452_1152594469 27 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594464_1152594469 -7 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594459_1152594469 0 Left 1152594459 17:81231684-81231706 CCTCGACCCTGCCAGGGGGAATG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594458_1152594469 3 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594462_1152594469 -6 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594454_1152594469 6 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594469 Original CRISPR GCCGGGTCAAGGGTGAGTGG AGG Intronic