ID: 1152594470

View in Genome Browser
Species Human (GRCh38)
Location 17:81231708-81231730
Sequence GCCTCCACTCACCCTTGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594470_1152594474 4 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG 0: 1
1: 0
2: 1
3: 9
4: 144
1152594470_1152594478 6 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594478 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1152594470_1152594482 23 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594470_1152594476 5 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594476 17:81231736-81231758 CCCCACTCCTGTCTCGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 144
1152594470_1152594481 15 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594481 17:81231746-81231768 GTCTCGCATGGGGGAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75
1152594470_1152594472 3 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594470 Original CRISPR GCCTCCACTCACCCTTGACC CGG (reversed) Intronic