ID: 1152594472

View in Genome Browser
Species Human (GRCh38)
Location 17:81231734-81231756
Sequence GCCCCCACTCCTGTCTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594465_1152594472 16 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594470_1152594472 3 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594459_1152594472 27 Left 1152594459 17:81231684-81231706 CCTCGACCCTGCCAGGGGGAATG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594462_1152594472 21 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594458_1152594472 30 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594464_1152594472 20 Left 1152594464 17:81231691-81231713 CCTGCCAGGGGGAATGGCCGGGT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594472 Original CRISPR GCCCCCACTCCTGTCTCGCA TGG Intronic