ID: 1152594481

View in Genome Browser
Species Human (GRCh38)
Location 17:81231746-81231768
Sequence GTCTCGCATGGGGGAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594470_1152594481 15 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594481 17:81231746-81231768 GTCTCGCATGGGGGAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75
1152594471_1152594481 -7 Left 1152594471 17:81231730-81231752 CCATGCCCCCACTCCTGTCTCGC 0: 1
1: 0
2: 0
3: 50
4: 476
Right 1152594481 17:81231746-81231768 GTCTCGCATGGGGGAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75
1152594465_1152594481 28 Left 1152594465 17:81231695-81231717 CCAGGGGGAATGGCCGGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1152594481 17:81231746-81231768 GTCTCGCATGGGGGAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594481 Original CRISPR GTCTCGCATGGGGGAGAACC TGG Intronic