ID: 1152594482

View in Genome Browser
Species Human (GRCh38)
Location 17:81231754-81231776
Sequence TGGGGGAGAACCTGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594477_1152594482 -6 Left 1152594477 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594471_1152594482 1 Left 1152594471 17:81231730-81231752 CCATGCCCCCACTCCTGTCTCGC 0: 1
1: 0
2: 0
3: 50
4: 476
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594479_1152594482 -7 Left 1152594479 17:81231738-81231760 CCACTCCTGTCTCGCATGGGGGA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594470_1152594482 23 Left 1152594470 17:81231708-81231730 CCGGGTCAAGGGTGAGTGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594473_1152594482 -4 Left 1152594473 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG 0: 1
1: 0
2: 2
3: 11
4: 176
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409
1152594475_1152594482 -5 Left 1152594475 17:81231736-81231758 CCCCACTCCTGTCTCGCATGGGG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1152594482 17:81231754-81231776 TGGGGGAGAACCTGGAGAGCAGG 0: 1
1: 0
2: 6
3: 34
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594482 Original CRISPR TGGGGGAGAACCTGGAGAGC AGG Intronic