ID: 1152595716

View in Genome Browser
Species Human (GRCh38)
Location 17:81236682-81236704
Sequence CAGGGGCCGCGCACGCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152595716_1152595725 27 Left 1152595716 17:81236682-81236704 CCTGAGCGCGTGCGCGGCCCCTG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1152595725 17:81236732-81236754 AGTTGCGTTTGAGGATGAGCAGG 0: 1
1: 0
2: 2
3: 4
4: 93
1152595716_1152595721 1 Left 1152595716 17:81236682-81236704 CCTGAGCGCGTGCGCGGCCCCTG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1152595721 17:81236706-81236728 ACCTGCAGCTTCCTGGATGAAGG 0: 1
1: 0
2: 4
3: 41
4: 378
1152595716_1152595724 18 Left 1152595716 17:81236682-81236704 CCTGAGCGCGTGCGCGGCCCCTG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1152595724 17:81236723-81236745 TGAAGGCAGAGTTGCGTTTGAGG 0: 1
1: 0
2: 2
3: 12
4: 157
1152595716_1152595718 -6 Left 1152595716 17:81236682-81236704 CCTGAGCGCGTGCGCGGCCCCTG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1152595718 17:81236699-81236721 CCCCTGTACCTGCAGCTTCCTGG 0: 1
1: 0
2: 0
3: 25
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152595716 Original CRISPR CAGGGGCCGCGCACGCGCTC AGG (reversed) Intronic