ID: 1152596721

View in Genome Browser
Species Human (GRCh38)
Location 17:81241453-81241475
Sequence AAGCCTGCAGACCTTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152596715_1152596721 24 Left 1152596715 17:81241406-81241428 CCCCGTTTTAAAACACTCTCACT 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 208
1152596716_1152596721 23 Left 1152596716 17:81241407-81241429 CCCGTTTTAAAACACTCTCACTA 0: 1
1: 0
2: 4
3: 33
4: 252
Right 1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 208
1152596717_1152596721 22 Left 1152596717 17:81241408-81241430 CCGTTTTAAAACACTCTCACTAA 0: 1
1: 0
2: 2
3: 29
4: 324
Right 1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152596721 Original CRISPR AAGCCTGCAGACCTTGCTGT GGG Intergenic
904106645 1:28090322-28090344 AATCTTGCAGAACTTGCTGATGG - Intergenic
904376193 1:30083934-30083956 AAGCCTCCAGGCCTGGCTTTGGG + Intergenic
904860415 1:33533464-33533486 AAGCCTGCAGCACTTCCTGAGGG + Intronic
905648539 1:39640804-39640826 CAGCAAGCAGGCCTTGCTGTGGG - Intergenic
906551589 1:46670254-46670276 AAGCCTAAAGATCTTGCTGATGG + Intronic
906607078 1:47180127-47180149 AAGCCAGCAGAACTTGCTCTGGG - Intergenic
906797975 1:48712578-48712600 AACCCTGCAGACCACACTGTGGG - Intronic
907773033 1:57485080-57485102 AAGCCTGTAGATCTTGAGGTTGG - Intronic
913536077 1:119773901-119773923 AAGCCTGCAGAGTTTGGTGAGGG + Intergenic
913642389 1:120825027-120825049 ACGCCTACTGACATTGCTGTTGG + Intronic
913642748 1:120828107-120828129 ACGCCTACTGACATTGCTGTTGG + Intronic
915895744 1:159809437-159809459 GGGCCTGCTGACCCTGCTGTGGG + Exonic
915896523 1:159815421-159815443 AACTCAGCAGACCTGGCTGTGGG - Exonic
916670378 1:167012980-167013002 AAGTCAGTAGACCTTGCTGATGG + Intronic
916786381 1:168090005-168090027 AGGCCAGCTGACCTTGCTGGAGG + Intronic
918210540 1:182347310-182347332 CTACCTGCAGACCTTGCTGCAGG + Intergenic
918378519 1:183932696-183932718 CAGCCTGCAGGCTTTGCAGTGGG + Intronic
919822791 1:201483584-201483606 ATGCCTGCAGCCCTTTCAGTGGG + Exonic
920095883 1:203486605-203486627 AAGTCTACAGTCCTTGCTCTCGG + Intronic
920282879 1:204857593-204857615 AAGTCTGCTGACCCTGCTGCTGG + Intronic
1062893107 10:1080466-1080488 TGGCCTGCATACCTTGCTGGTGG - Exonic
1067027315 10:42855707-42855729 AAACCTCCAAAACTTGCTGTTGG - Intergenic
1069257409 10:66350621-66350643 AAGCCTGGAGAAATTGCTGAAGG + Intronic
1071068926 10:81669414-81669436 AAGCCTGAAGACCAGGCTGCTGG + Intergenic
1071412002 10:85406303-85406325 AACCCTGTAGGCCTTGGTGTGGG - Intergenic
1075530242 10:123223009-123223031 AAGCCTTCACACCTTGTTGGTGG + Intergenic
1075549002 10:123378442-123378464 AAGCCTGCAGACATTTCTATTGG - Intergenic
1076904842 10:133356615-133356637 AAGCCTGCAGCCCCAGTTGTGGG - Intronic
1077473406 11:2775389-2775411 TAGCCTGCAGCACTTGCTGTGGG - Intronic
1080824034 11:35832866-35832888 AAGCCTGCAGTCATTGCTGTAGG + Intergenic
1081599611 11:44484121-44484143 AAGCCGGCAGACATTGCCCTGGG - Intergenic
1087402352 11:97683929-97683951 TAGCCTGCAGTGCTTCCTGTAGG - Intergenic
1089752057 11:120659130-120659152 AAGCCAGCAGAGCTGGCTGTCGG + Intronic
1090976267 11:131683152-131683174 AAGCATGCAGACCTTCTGGTTGG - Intronic
1091448130 12:556456-556478 AAGCCTGCAAAGCTAGTTGTTGG - Intronic
1095573868 12:43712620-43712642 AAGCCTTCAGACCATGGTATGGG + Intergenic
1095719565 12:45385971-45385993 AATCCTGCAGACCCTGCAGCAGG - Intronic
1098216220 12:68223097-68223119 AAGACTGCAGACATTGATTTAGG - Intronic
1100189189 12:92172559-92172581 AAGCCTGCAGAGCTACCTCTGGG + Intergenic
1104796631 12:131524448-131524470 AAGCATGCGGACCTTGTAGTGGG - Intergenic
1104928287 12:132325001-132325023 CAGCTTGCAGACATGGCTGTGGG + Intronic
1105913923 13:24894954-24894976 AAGCCAGCAGGCCTGGCTGGCGG + Intronic
1110346505 13:74453807-74453829 AAGTCTGTCAACCTTGCTGTGGG - Intergenic
1111176530 13:84603613-84603635 ATGCCTTCAGACCTTGGTCTAGG - Intergenic
1111254745 13:85651682-85651704 AGGGCTGCAGACCTAGCTGAAGG - Intergenic
1111373840 13:87352864-87352886 AAGACTGCTTACCTTGTTGTAGG + Intergenic
1113761847 13:112853609-112853631 AAGCCTGCAGACGCTGCAGAAGG - Intronic
1114529387 14:23386314-23386336 GAGCCTCCAGAGCTTGCTGAAGG - Exonic
1118603861 14:67488882-67488904 AAGCCTGCAGACCAGGAAGTGGG - Intronic
1118929814 14:70231030-70231052 ATGCCTGCCGACCTGGTTGTAGG + Intergenic
1122236997 14:100336968-100336990 AAGCCTTCATGCCTGGCTGTTGG + Intronic
1122265713 14:100545895-100545917 AAGCATGCAACCTTTGCTGTTGG - Intronic
1122503993 14:102220041-102220063 AAGCCTGCAGCCCTCGCGTTGGG + Intronic
1124023736 15:25945945-25945967 AAGCCAGCAGACCCGGCTGCAGG - Intergenic
1125150380 15:36523991-36524013 AAGCCAGAAGTTCTTGCTGTGGG - Intergenic
1127541280 15:59941341-59941363 AAGAATGAAGACCTTACTGTTGG + Intergenic
1129504073 15:76066513-76066535 AACCCTTCAGACCTTGCTATAGG + Intronic
1130182328 15:81643185-81643207 CTGCCTGCAGACCTTGCACTTGG + Intergenic
1130973045 15:88749597-88749619 AAGACTGGAGGCCTTGCTATAGG - Intergenic
1131114148 15:89783944-89783966 CAGCCTGCGGAGCTGGCTGTGGG + Intergenic
1131695778 15:94876213-94876235 AAGCCTGAAAACCAGGCTGTCGG - Intergenic
1131922959 15:97350278-97350300 AATCCTGTGGCCCTTGCTGTAGG - Intergenic
1132609871 16:810309-810331 GAGGCTGCAGAGGTTGCTGTGGG + Intronic
1132677569 16:1127000-1127022 GAGCCTGCTGAGCTTGCTGGTGG - Intergenic
1134014245 16:10877682-10877704 AGGCGAGAAGACCTTGCTGTGGG - Intronic
1139325936 16:66152591-66152613 AGGCCTGCACATCTTTCTGTAGG - Intergenic
1142010789 16:87712803-87712825 GAGGCTGGAGAACTTGCTGTGGG + Intronic
1142420983 16:89969851-89969873 ATCCCTGGAAACCTTGCTGTTGG - Exonic
1143540954 17:7568656-7568678 AGGCCTGGAGACCATCCTGTGGG - Intronic
1143600798 17:7944557-7944579 AAGACTGCAGGCCATGCTGCAGG + Exonic
1144579334 17:16449486-16449508 GTGCCTGGAGAGCTTGCTGTGGG - Intronic
1145905248 17:28512715-28512737 AAGCTTGCTGACCTTGCTTCTGG + Intronic
1146919844 17:36703222-36703244 AAGACTGCAGACCTCCCTGGTGG - Intergenic
1148127871 17:45246115-45246137 AAGCCAGCTGTCCTTGCTGTGGG + Intronic
1149088644 17:52751292-52751314 GAGCCTGCAGAGATTGCAGTGGG - Intergenic
1150702270 17:67458158-67458180 GAGCCTTCAGACCATGGTGTAGG - Intronic
1151356122 17:73559669-73559691 CAGGCTGCAGACCTGCCTGTGGG - Intronic
1151445983 17:74164300-74164322 GAGCCTGCAGGACTTGCTGATGG - Intergenic
1151887206 17:76930117-76930139 AAGCCTGGAGTTCTTTCTGTGGG - Intronic
1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG + Intergenic
1154314242 18:13291583-13291605 CAGCCTGCAGAGCCTACTGTGGG - Intronic
1157604149 18:48915119-48915141 AACCCTGCAGCCCTGGCTGCTGG + Intergenic
1159891349 18:73956007-73956029 AAGTCTGCAGACCTTTCTAGAGG + Intergenic
1159898978 18:74024642-74024664 ACTCCTGAAGACCTTCCTGTGGG - Intergenic
1160420041 18:78737730-78737752 ATTCCTGCAGACCCAGCTGTTGG - Intergenic
1160438005 18:78866350-78866372 AAACCTGCAGACCTGGCTAGAGG + Intergenic
1160438056 18:78866601-78866623 AAACCTGCAGACCTGGCTAGAGG + Intergenic
1161263086 19:3348306-3348328 AAGGCTGCAGAGCTACCTGTGGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162995628 19:14333480-14333502 TAGCCTGCAAGCCTTGCTGGTGG + Intergenic
1165285617 19:34839234-34839256 GAGCCTGCAGACCTGGCTGCTGG - Intergenic
1166123946 19:40702655-40702677 GAGCCTGCAGGCCTTGCAGCAGG - Exonic
1166734386 19:45075791-45075813 CTGCCTGCAGACCTTCCCGTTGG - Exonic
1167259637 19:48451089-48451111 GAGCATGCAGGCCTTGCTGGGGG - Exonic
925945150 2:8855219-8855241 AATCCTACAGACCTTGCTAATGG + Exonic
927947562 2:27146225-27146247 ATGACTGCAGCCCTGGCTGTCGG - Intergenic
931334909 2:61329871-61329893 AATCATGCAGACCTAGCTCTAGG - Intronic
932690724 2:73911035-73911057 AACCCTGAAGACCTTCCAGTGGG - Intronic
935805131 2:106738237-106738259 AAACCTTCAGACATTGCTGGTGG - Intergenic
936457140 2:112683664-112683686 ATGCTGGCAGCCCTTGCTGTGGG + Intergenic
936983633 2:118287660-118287682 GAGCCAGCAGGACTTGCTGTTGG + Intergenic
941502722 2:166299954-166299976 AAGTCTGTAGAGCTTGCTGATGG - Intronic
942395797 2:175548198-175548220 AAACCTGCAGTCATTGCAGTGGG - Intergenic
942871705 2:180742272-180742294 AAGCCATCAGAACTTGCTGATGG - Intergenic
943562851 2:189484000-189484022 ATGCGTGCAGGCCTTGCTGCCGG + Intergenic
944315587 2:198282073-198282095 AAGGCTGCTGACCATCCTGTGGG + Intronic
945907670 2:215613426-215613448 ATGCCTGCAAGCCTAGCTGTAGG - Intergenic
946418579 2:219552524-219552546 AGGCGGGCAGACCTTCCTGTCGG + Exonic
946424984 2:219589663-219589685 AAGACTGGACACCTTGGTGTAGG + Intergenic
946643983 2:221814290-221814312 AAGCCTTGTGACCCTGCTGTAGG + Intergenic
948720579 2:239897729-239897751 AAGCCACCAAACCCTGCTGTTGG + Intronic
1169288478 20:4328968-4328990 AAGCCTGCAGCCCTTGCTCTTGG - Intergenic
1170909868 20:20555586-20555608 AAAACTGCAAACCTTGCTGTAGG - Intronic
1171104726 20:22421478-22421500 GAGCCTTCAGACCATGCTGCGGG - Intergenic
1173167863 20:40698715-40698737 GAGCCTTCAGACCGTGATGTTGG + Intergenic
1173469104 20:43308900-43308922 AAGCCTCCCGAACTTGCAGTTGG + Intergenic
1175011310 20:55739953-55739975 ATGCCTGCACACATTCCTGTTGG - Intergenic
1175123861 20:56737256-56737278 AAGCCTGCTTACCTTGCTAATGG + Intergenic
1179596575 21:42446724-42446746 CAGCCTGCAGACCTTTGTGGTGG + Intronic
1180785495 22:18544875-18544897 AAGCCTGCAGAGCATACTCTGGG - Intergenic
1180836935 22:18934608-18934630 AAGCCAGCAGAGCTGGGTGTGGG - Intronic
1180884335 22:19229864-19229886 ACTCCTGCAGACATGGCTGTTGG - Exonic
1181052137 22:20242982-20243004 CAGCCTGCAGGCCCTGCTGGGGG + Exonic
1181129080 22:20718917-20718939 AAGCCTGCAGAGCATACTCTGGG - Intronic
1181242399 22:21484228-21484250 AAGCCTGCAGAGCATACTCTGGG - Intergenic
1181509262 22:23381755-23381777 AACCCTGCAGCCCCTGCCGTGGG - Intergenic
1183041599 22:35183292-35183314 AAGCTTGGAGGCTTTGCTGTTGG - Intergenic
1184615158 22:45633022-45633044 AAGCCTGCATTCCCTTCTGTGGG + Intergenic
1184641674 22:45876306-45876328 AATCCTTCAGACCTTCCTGGGGG + Intergenic
1203287028 22_KI270734v1_random:159907-159929 AAGCCAGCAGAGCTGGGTGTGGG - Intergenic
949699912 3:6744950-6744972 AAGACTGCAGAGCTTACTATTGG - Intergenic
949871559 3:8593736-8593758 AAGCCTCCAGGCCTTGCCTTTGG - Intergenic
950242654 3:11385604-11385626 AAGAGGACAGACCTTGCTGTAGG - Intronic
952690277 3:36197367-36197389 AAGTCTGCAGCCCTGGCAGTGGG - Intergenic
954327397 3:49870980-49871002 GAGCCTCCTGACCCTGCTGTGGG + Intergenic
955069283 3:55558977-55558999 GTGTCTCCAGACCTTGCTGTGGG - Intronic
955867680 3:63402279-63402301 AAGCCTGGAGACATTTCTGATGG - Intronic
955921429 3:63960594-63960616 AAGCCAGCAGGGCTTGCTGATGG + Intronic
956054457 3:65283882-65283904 AAGGCTTCAGACCTTGAAGTAGG - Intergenic
956534022 3:70255586-70255608 ATGCCTGCAGTCCTAGCTGCAGG - Intergenic
957957160 3:87202259-87202281 AAGGTGGCAGACCTTGCCGTTGG + Intergenic
958075302 3:88668748-88668770 AAGCCAGAAGACCTTGATGGTGG + Intergenic
959870923 3:111326762-111326784 AAACCCGCCTACCTTGCTGTTGG - Intronic
961070505 3:123919679-123919701 AGGCAGGCAGACCTTGCTGTTGG - Intronic
961542830 3:127611649-127611671 AAGCCTGCAGGGCTTCCTGCTGG - Intronic
961870488 3:129984205-129984227 AAGCCTGCAGCAGATGCTGTGGG - Intergenic
963769755 3:149378204-149378226 CATCCTGCAGAGCTTGCTGTAGG - Intergenic
966947893 3:184790170-184790192 AAGCCAGCAGAATTTGCTGACGG + Intergenic
967414657 3:189202760-189202782 CAGCCTGCAGCGCTCGCTGTGGG + Intronic
968215451 3:196885939-196885961 TAGCTTGCAAACCTTGCTTTTGG - Exonic
968329322 3:197851830-197851852 CAGCCTCCAAACCTTGCTTTGGG - Intronic
968537436 4:1143197-1143219 AAGACTGCAGACCATGGTTTGGG - Intergenic
972001371 4:34039557-34039579 AACCCTGAAGACCTTCCAGTAGG - Intergenic
975566015 4:75754965-75754987 ATGACTGCAGACCTGGCTGATGG - Intronic
976226107 4:82797081-82797103 AATCCTGCAGTCCCTGCTCTTGG - Intronic
976235759 4:82895195-82895217 AAGCCACCACACCTGGCTGTTGG - Intronic
977495627 4:97771655-97771677 ATGTCTGCATACCTTGCTCTGGG - Intronic
978503172 4:109431124-109431146 TTGCCTGGAGAGCTTGCTGTAGG + Intergenic
984549532 4:181144210-181144232 AAGTCTGCAGACCTTGTCGCTGG - Intergenic
984834869 4:184010360-184010382 ACGCCGGAAGACCTTGCTGAAGG + Exonic
986417948 5:7547176-7547198 AAGCCAGCAGTCTCTGCTGTGGG - Intronic
987076824 5:14390641-14390663 ACGCGTGCAGAGCTGGCTGTGGG - Intronic
987120843 5:14765032-14765054 AAGCGTGCTGACCTTGCATTTGG - Intronic
988600036 5:32631307-32631329 GCCCCTCCAGACCTTGCTGTGGG - Intergenic
990206417 5:53434279-53434301 GAGCCAGCAGACCTAGGTGTAGG + Intergenic
990283891 5:54280177-54280199 GAGCCTTCAGACCATGCTGTAGG - Intronic
990980590 5:61599519-61599541 AGTCCTGCAGAGCTTCCTGTAGG + Intergenic
992005669 5:72475192-72475214 CAGCCTGAAGACCTTCCTGTAGG + Intronic
997743882 5:136281563-136281585 AACTCTGCAGGCCTTGCTGGTGG + Intronic
998045313 5:138982346-138982368 CACCCTGCACACCTTGCTGGTGG - Intronic
998586603 5:143433638-143433660 AAGCCTGCAGGAGTTGCTGGAGG - Intronic
999009468 5:148019747-148019769 ATGTCTGCAGACATTGCTGGGGG + Intergenic
1001520076 5:172385175-172385197 AATCCTGCAGCCCTTGCAGTTGG + Intronic
1002314993 5:178337675-178337697 AAGCCTGCAGTCCTGGATGGCGG - Intronic
1004750569 6:18557899-18557921 GAGCCTTCAGACCATGCTGCAGG - Intergenic
1004886782 6:20058938-20058960 AAGCCTGCTGACCATGAAGTGGG + Intergenic
1005756911 6:28933156-28933178 AACCCTGCAGACTTTGATCTTGG - Intergenic
1006082729 6:31576793-31576815 AAGCCTGTAGCCCATGTTGTAGG + Exonic
1007642892 6:43357052-43357074 AAGCCTGCTTACTTTCCTGTGGG - Intronic
1009700225 6:67167724-67167746 ATGTCTGCAGTCCGTGCTGTAGG + Intergenic
1010025645 6:71213023-71213045 AACCCTGCTGACCTTGGTTTTGG + Intergenic
1011500452 6:87982539-87982561 AGGCAGGCAGACCTTGCTGTTGG - Intergenic
1011770347 6:90668862-90668884 AAGCCTGCAAAATTTGCTTTGGG + Intergenic
1014800744 6:125775830-125775852 AAGCCTGCAAACCTTGGTGAAGG + Intergenic
1015678759 6:135781038-135781060 GAGCCTACAGGGCTTGCTGTAGG + Intergenic
1017033462 6:150245151-150245173 GAGCCAGTAGACCTTGCTGCTGG - Intronic
1019618830 7:1979627-1979649 CGGCCTGCAGACCCTGCTCTAGG + Intronic
1020788384 7:12595388-12595410 AAGTCTGGTGACCTTGCTGTAGG + Intronic
1021624670 7:22581240-22581262 AAGACTGCAGAGCTGGCTGGAGG - Intronic
1022236432 7:28466392-28466414 AAGCCTGTAGGCGTTGCAGTTGG + Intronic
1022744286 7:33154353-33154375 AAGTCTGCAGACCTAGGTGGGGG - Intronic
1024662864 7:51515381-51515403 ACTCCTGCAGTCCTTGCTGCAGG - Intergenic
1024724699 7:52179478-52179500 AAACCTGCAGGCCCTCCTGTGGG - Intergenic
1028791838 7:94862191-94862213 AAGCATGCAGTCCATGCAGTGGG + Intergenic
1033639656 7:143249273-143249295 ATGCAGGCAGACCTTGCTCTTGG - Intronic
1034433748 7:151053443-151053465 CAGCCTGCAGGCCTTGGTATGGG + Intergenic
1035061045 7:156069899-156069921 ATGCCTGCTGACCTTGGTTTGGG + Intergenic
1036044726 8:5127052-5127074 AAGACTGCAGCTCTTTCTGTAGG + Intergenic
1037789597 8:21925495-21925517 AAGACTGGAGAACTCGCTGTTGG + Intronic
1038197630 8:25382722-25382744 CAGCCTGAATACTTTGCTGTTGG + Exonic
1040940805 8:52830825-52830847 AGGCCTTCAGTCCTTACTGTTGG - Intergenic
1043042057 8:75275888-75275910 AATCATGCAGTACTTGCTGTGGG + Intergenic
1043981914 8:86652698-86652720 GAGCCTGAAGACCTTCCAGTGGG - Intronic
1045686305 8:104715869-104715891 AAGCCTACCCACCTGGCTGTTGG - Intronic
1045856780 8:106773178-106773200 TAGCATACAGACCTTGCTTTAGG - Intergenic
1047513304 8:125531837-125531859 ACGCTTGCAGACCTTGCCCTAGG - Intergenic
1049591365 8:143464434-143464456 CAGCCTGCAGCCCCTGCTGCCGG - Intronic
1052558315 9:30049249-30049271 AAGCCTGAAAACCAAGCTGTTGG - Intergenic
1054854825 9:69887663-69887685 AAGATGGCAGACCTTCCTGTTGG + Intronic
1055645440 9:78357677-78357699 AAGCCTGGAGGCCTGGCTGCTGG + Intergenic
1055978596 9:81977825-81977847 AAGCCTGCAGTCCTCTCTGCTGG - Intergenic
1057301978 9:93891809-93891831 AGTCCTGCAGACCTCCCTGTGGG + Intergenic
1057784206 9:98074374-98074396 TAGCCTGCCGACCGTGCTATCGG - Intronic
1058267340 9:102919177-102919199 AAACCTGCATACATTGCTGGAGG - Intergenic
1058316128 9:103569071-103569093 AAGCCTGTAGCCCTAGCTGCTGG - Intergenic
1058594620 9:106602097-106602119 GACACTGCAGACTTTGCTGTAGG + Intergenic
1060413596 9:123415634-123415656 AGGCCTGGAGACCCTGCGGTGGG - Intronic
1060829788 9:126706181-126706203 AAGCCTGCTGACCTTGCTCGAGG - Intergenic
1062417024 9:136456473-136456495 AAGCATGCAGACATTCCTGGGGG - Intronic
1186231950 X:7464803-7464825 AAGCCTGCAGTCCTTATTATTGG + Intergenic
1186847355 X:13543961-13543983 AAGCTTGCAGATCTTACTGTTGG - Intergenic
1190714796 X:53094204-53094226 TATCCTTCAGATCTTGCTGTAGG + Intergenic
1191695958 X:63990733-63990755 GACCCTGCAGACTTTGCTGGCGG + Intergenic
1193301425 X:79892690-79892712 AAGCCTGGTGACTTTTCTGTAGG - Intergenic
1198073646 X:133174088-133174110 AAGCCTGGAGAACTTGGTGAAGG + Intergenic
1199347715 X:146761290-146761312 AAGTCTGCAGGCCTTCCTCTTGG - Intergenic
1199347717 X:146761299-146761321 AGGCCTGCAGACTTTGGTCTTGG + Intergenic
1200967440 Y:9110094-9110116 ACACCTGGAGACCTGGCTGTGGG + Intergenic
1202143276 Y:21751460-21751482 ACACCTGGAGACCTGGCTGTGGG + Intergenic