ID: 1152598199

View in Genome Browser
Species Human (GRCh38)
Location 17:81248505-81248527
Sequence AGCCGCTTGCGGCAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152598199_1152598201 21 Left 1152598199 17:81248505-81248527 CCAGTTATTTGCCGCAAGCGGCT 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1152598201 17:81248549-81248571 AGATGTTTTCAAATTATTATAGG 0: 1
1: 0
2: 3
3: 80
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152598199 Original CRISPR AGCCGCTTGCGGCAAATAAC TGG (reversed) Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
907093344 1:51750824-51750846 AGCCACTTGCTGGAAATAAAGGG - Intronic
907299349 1:53476845-53476867 AGCCTCATGTGGCAAAGAACAGG + Intergenic
919606453 1:199690029-199690051 AGCAGTTTGGGGAAAATAACTGG + Intergenic
1091133989 11:133171346-133171368 AGCGGATTGAGGCAAATAACAGG - Intronic
1116787859 14:49307865-49307887 AACAGTTTGCAGCAAATAACCGG - Intergenic
1119094049 14:71812569-71812591 AGCTGCTTGGGTCAAAAAACTGG - Intergenic
1127320953 15:57845720-57845742 AGCCGCTTACTGCAAGTAAAGGG - Intergenic
1132492426 16:239983-240005 AGCTGCTTGCTGTAAACAACTGG + Intronic
1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG + Intronic
1143839731 17:9722639-9722661 AGCACCTTGCAGGAAATAACTGG - Intronic
1152598199 17:81248505-81248527 AGCCGCTTGCGGCAAATAACTGG - Intronic
930535770 2:52644370-52644392 TGCCACTTGCTGCATATAACTGG + Intergenic
931861061 2:66355054-66355076 TGCCAGTTGCTGCAAATAACTGG - Intergenic
1172842122 20:37908273-37908295 AGTCGCCTGCGGCAAACAAGTGG + Intronic
1182467802 22:30528798-30528820 CTCCGCTTGCAGCTAATAACTGG + Intronic
951405270 3:22289553-22289575 AGCCTCTTGCAGGAAAAAACTGG + Intronic
967655986 3:192049550-192049572 ACCACCTTGTGGCAAATAACAGG - Intergenic
1017842564 6:158233034-158233056 ACCCGCTTGGGGCAATTAGCTGG + Intronic
1020762062 7:12279953-12279975 AGCCTCTTGGGGCACAGAACTGG + Intergenic
1025971576 7:66331123-66331145 AGGCTCATGTGGCAAATAACTGG - Intronic
1027138374 7:75639797-75639819 AGCCGCAGGAGGCAAACAACTGG - Intronic
1029169119 7:98618197-98618219 AGCCGCGGGCGCCAAATACCCGG + Intronic
1031918688 7:127585720-127585742 GGCCGCGAGCGGCAAAAAACAGG + Intronic
1035242685 7:157542551-157542573 AGCCACTTGCGGCATCCAACAGG + Intronic
1042325209 8:67521140-67521162 GGCTGCTTGCAGCAAATACCTGG - Intronic
1053151694 9:35747926-35747948 AGCTGCTTGTGGGAAATAAGGGG + Intronic