ID: 1152598297

View in Genome Browser
Species Human (GRCh38)
Location 17:81248982-81249004
Sequence CACGTGGCCCACGGCCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152598297_1152598304 -3 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598304 17:81249002-81249024 GTGCTCGCCCTGGGTGCTGCGGG 0: 1
1: 1
2: 1
3: 15
4: 189
1152598297_1152598303 -4 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598303 17:81249001-81249023 CGTGCTCGCCCTGGGTGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 153
1152598297_1152598308 9 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598308 17:81249014-81249036 GGTGCTGCGGGGCTCAACCACGG 0: 1
1: 0
2: 1
3: 7
4: 115
1152598297_1152598309 20 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598309 17:81249025-81249047 GCTCAACCACGGAATGTCAATGG 0: 1
1: 0
2: 0
3: 5
4: 40
1152598297_1152598311 27 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598311 17:81249032-81249054 CACGGAATGTCAATGGTACAAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1152598297_1152598305 -2 Left 1152598297 17:81248982-81249004 CCACCTCGGCCGTGGGCCACGTG 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1152598305 17:81249003-81249025 TGCTCGCCCTGGGTGCTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152598297 Original CRISPR CACGTGGCCCACGGCCGAGG TGG (reversed) Intronic
900180429 1:1308750-1308772 CACGTGGGCCCGGGCGGAGGCGG + Intronic
900418217 1:2544693-2544715 CACGTGGCCTGGGGTCGAGGGGG + Intergenic
903345371 1:22680957-22680979 AACATGGCCAACGGCTGAGGCGG + Intergenic
903999829 1:27332620-27332642 CACCAGGCCCACAGCTGAGGTGG - Intronic
906632424 1:47383320-47383342 CACGTGGCCTAAGGCAGATGTGG - Intergenic
916745366 1:167680959-167680981 CTCCTGGCCCATGGCTGAGGTGG + Intronic
923125754 1:231033185-231033207 CACGTGGGCAAAGGCCAAGGCGG + Intronic
1067852490 10:49762453-49762475 GAGGTCGCCCACGGCCGAAGGGG + Intergenic
1071309438 10:84328768-84328790 CAGCTGGGCCGCGGCCGAGGAGG + Exonic
1075999247 10:126902625-126902647 CAGGTGGACCACGGGCCAGGTGG - Intergenic
1076701305 10:132274763-132274785 GAGGTGGCCGACTGCCGAGGAGG - Intronic
1076846269 10:133071013-133071035 CACGGTGCACACTGCCGAGGGGG + Intronic
1076850545 10:133090312-133090334 CGGGTGGCCCCGGGCCGAGGAGG - Intronic
1077916055 11:6612118-6612140 CGCGGGGCCCGGGGCCGAGGCGG + Exonic
1094503066 12:31037398-31037420 CATGTGGCCCACAGCAGAGGTGG + Intergenic
1101357793 12:103996801-103996823 CGCGTGGCCCAGGGCCAAGGTGG + Exonic
1107438393 13:40402526-40402548 CACTTGGCCCAGGGCCGAGAGGG + Intergenic
1114069994 14:19098621-19098643 CACCTGGGCCCCGGTCGAGGCGG - Intergenic
1114092268 14:19301381-19301403 CACCTGGGCCCCGGTCGAGGCGG + Intergenic
1125444244 15:39736607-39736629 CCTGTGGCCCACGGGGGAGGAGG - Intronic
1125524771 15:40368025-40368047 CTCGTGGAGCACGGCGGAGGCGG - Exonic
1130104913 15:80921919-80921941 CACGCGGCCCACGCCGGAGATGG - Intronic
1132206984 15:99993101-99993123 CACGAGGCCGAGAGCCGAGGAGG - Exonic
1139047577 16:63081327-63081349 CAAGTGGCCCATGGGCCAGGGGG + Intergenic
1139766088 16:69231299-69231321 GATGTGGCCCGCGGACGAGGTGG + Intronic
1141361270 16:83397124-83397146 GGGGTTGCCCACGGCCGAGGAGG - Intronic
1141673993 16:85507985-85508007 CCTGTGGCCCCCTGCCGAGGTGG + Intergenic
1148323495 17:46771059-46771081 CACTCGGCCCACAGCCCAGGAGG - Intronic
1148777322 17:50102877-50102899 CACGTGGCCAACGGCCAACACGG - Intronic
1150738994 17:67764605-67764627 GACGTGGCCCAGGGTCCAGGTGG + Intergenic
1151357976 17:73571652-73571674 CACATGCCCCACACCCGAGGAGG - Intronic
1151411975 17:73936973-73936995 CAGGGGGCCCACTGCCCAGGTGG + Intergenic
1152364966 17:79850206-79850228 CACGTGGCTGAGGGCGGAGGAGG + Intergenic
1152588005 17:81197631-81197653 CACCTGGCCCTCGGGGGAGGAGG - Intronic
1152598297 17:81248982-81249004 CACGTGGCCCACGGCCGAGGTGG - Intronic
1152640055 17:81445543-81445565 CACGGGGCGCTGGGCCGAGGTGG - Exonic
1153008310 18:515269-515291 CGCGTGGCCGAGGTCCGAGGAGG - Intergenic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160455196 18:78994627-78994649 CAGGTCGCCCACGGCCGACGAGG - Exonic
1160725672 19:616830-616852 TAGGTGGCCCCCGTCCGAGGAGG + Exonic
1160736975 19:667396-667418 CAGGTGGACCACGTCCCAGGCGG + Intergenic
1160736990 19:667443-667465 CAGGTGGACCACGTCCCAGGCGG + Intergenic
1160986147 19:1839859-1839881 CCCGTGCACCACGGCCGAGGAGG - Intronic
1161003074 19:1920888-1920910 CACGTGCACGAGGGCCGAGGGGG - Intronic
1161046184 19:2136139-2136161 CATGTCGCCCGCGGCCCAGGCGG + Intronic
1161516574 19:4699886-4699908 CACGTCACCCACTCCCGAGGTGG + Intronic
1161990241 19:7680696-7680718 GACGTGGCCCACGGCCGTGATGG - Intronic
1166139613 19:40799142-40799164 CACGTGCCCACCGGGCGAGGCGG + Intronic
1167222910 19:48214712-48214734 CACTTGGAAGACGGCCGAGGGGG - Intronic
934105598 2:88691917-88691939 CACGATGTCCAAGGCCGAGGAGG + Exonic
937062502 2:118990990-118991012 CAAGTGGGCCACAGCTGAGGTGG - Intronic
937255973 2:120555790-120555812 CAGGTGGCCCAGGGGCAAGGAGG + Intergenic
943589899 2:189784422-189784444 CACGTTGCCCCCGGGCGAGGCGG + Exonic
948753208 2:240144274-240144296 CACGAGGCCCTCCCCCGAGGTGG - Intronic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
949035227 2:241813101-241813123 CCGGTGGCCCAGGGCAGAGGTGG + Intronic
1174297690 20:49560837-49560859 CACGAGGGCCAAGGCCAAGGTGG + Intronic
1175868281 20:62193244-62193266 GACGTGACCCAGGGCCGAGAGGG + Intronic
1176100879 20:63364002-63364024 CACTTGGCCCAGGGCTGATGTGG + Intronic
1176140210 20:63541651-63541673 CACGGGGCCAACGGCCGGTGAGG + Intronic
1178502806 21:33139871-33139893 CACCCGGCCCACCCCCGAGGAGG + Intergenic
1179842012 21:44082848-44082870 CACGTGGACCACGGCATTGGAGG - Exonic
1180008073 21:45032520-45032542 CACGTGGGGCCAGGCCGAGGGGG + Intergenic
1180488462 22:15821185-15821207 CACCTGGGCCCCGGTCGAGGCGG - Intergenic
1180711526 22:17842475-17842497 CACGTGCCCCACCACTGAGGGGG + Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181518738 22:23433378-23433400 CAGGTGGCCCACGGGCTGGGAGG - Intergenic
1184035178 22:41914775-41914797 GAGGAGGCCGACGGCCGAGGCGG - Intergenic
953404847 3:42655021-42655043 CACGTGGCCCAAGGCCCAGGCGG - Intronic
956731961 3:72204378-72204400 CATGAGGCCCAGGGCCCAGGTGG + Intergenic
960945147 3:122961206-122961228 CAGGCGGCCCAGGGACGAGGTGG + Exonic
967858256 3:194134273-194134295 CACGTGGCACCCGGCGGCGGCGG + Intergenic
968461899 4:730373-730395 CACGTGGCCCACGGGGGTGGGGG - Intronic
976704712 4:88008113-88008135 CACGGAGCTCACGGCCGAGGAGG - Exonic
1002434133 5:179220941-179220963 CACGTGGCTCATGGCCGGGTAGG - Intronic
1005479993 6:26246708-26246730 CACGTAGACCACGGCCATGGCGG + Exonic
1005759029 6:28950702-28950724 CACCTGGCACACGGGCGCGGTGG - Intergenic
1005885684 6:30095937-30095959 CACGTGGCCCAGGTCCCTGGTGG - Intergenic
1011515009 6:88144569-88144591 CACCAGGCCCAAGGCCGTGGTGG - Exonic
1013284582 6:108670143-108670165 CACTTGGCCCAAGACCAAGGAGG - Intronic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1019430321 7:996146-996168 CCCGAGGGCCACGGCTGAGGAGG + Intergenic
1028796229 7:94907546-94907568 CCCCTCGCCCACGGCCGAGGGGG + Intronic
1033366077 7:140673305-140673327 CCCGAGGCCCGCGGCCCAGGCGG - Exonic
1037876574 8:22551666-22551688 CTGGTGGCCCCCTGCCGAGGAGG - Intronic
1043847183 8:85177176-85177198 AATGAGGCCCACGACCGAGGGGG - Intergenic
1045575385 8:103414959-103414981 CACGGCGCCCAGGGCCGCGGAGG + Exonic
1050287557 9:4118493-4118515 CACGTCGCCCACGTCCTTGGTGG - Exonic
1060155586 9:121317897-121317919 CAGCTGGCCCAGGGCCCAGGGGG - Intronic
1061663501 9:132146741-132146763 CACGCGCCGCACGGCCGAGAGGG - Intergenic
1062113460 9:134795328-134795350 CACGCCGCCCACCGCCCAGGAGG - Intronic
1062313722 9:135954566-135954588 CAGGTGACCCATGGCCCAGGAGG + Intronic
1189002794 X:36963746-36963768 CCCGCGGCCCGCGGCGGAGGTGG - Intergenic
1200053042 X:153444849-153444871 CACGTCGCCCTCGGCTGAGTGGG + Exonic