ID: 1152604465

View in Genome Browser
Species Human (GRCh38)
Location 17:81282197-81282219
Sequence TGAACACGGTGTAGAAGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604458_1152604465 21 Left 1152604458 17:81282153-81282175 CCTTTCAGCGGGTACCCACGCGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 123
1152604461_1152604465 -6 Left 1152604461 17:81282180-81282202 CCGACTCACCACGAACATGAACA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 123
1152604460_1152604465 6 Left 1152604460 17:81282168-81282190 CCACGCGCGCTGCCGACTCACCA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 123
1152604459_1152604465 7 Left 1152604459 17:81282167-81282189 CCCACGCGCGCTGCCGACTCACC 0: 1
1: 0
2: 1
3: 5
4: 55
Right 1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604465 Original CRISPR TGAACACGGTGTAGAAGAGG AGG Exonic
900920497 1:5667427-5667449 TGCACAAGGGGTAAAAGAGGGGG - Intergenic
901154288 1:7125125-7125147 TTAACACGGTGTAGATGCAGAGG - Intronic
905777204 1:40676300-40676322 TGAACACTGTGTAGAGGGGATGG + Intergenic
906206043 1:43986961-43986983 TGAACACGGGGTAGGAGTGGGGG + Intronic
907028051 1:51141608-51141630 TGAAGAAGGTGTTTAAGAGGTGG + Intronic
908162301 1:61422383-61422405 TGAACATGGTGTTGAAAACGTGG - Intronic
909848412 1:80428740-80428762 TTAACACTGAGTAGAGGAGGTGG + Intergenic
910506991 1:87960463-87960485 TAAACTTGATGTAGAAGAGGTGG - Intergenic
913234567 1:116768619-116768641 TGAACACGGTGTCCAGGAGGCGG - Exonic
923378051 1:233386178-233386200 TAAGCATGGTGTAGAAGATGAGG + Intergenic
1063461852 10:6219972-6219994 TGAACACTGTGTAGAAGTACAGG + Intronic
1067142117 10:43666740-43666762 TGAACGTGGTGCAGAAGAGCTGG - Intergenic
1068335150 10:55625819-55625841 TTAGGACAGTGTAGAAGAGGAGG - Intronic
1072747999 10:97955256-97955278 AGAACCCTGAGTAGAAGAGGGGG + Intronic
1077065820 11:640531-640553 TGAAGACAGTGTAGATGACGGGG - Exonic
1077600846 11:3573473-3573495 AGATCACGCTGTAGCAGAGGAGG - Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1082864406 11:57885587-57885609 TGAGAAGGGTGGAGAAGAGGAGG - Intergenic
1084256767 11:67948059-67948081 AGATCACGCTGTAGCAGAGGAGG - Intergenic
1084816006 11:71647214-71647236 AGATCACGCTGTAGCAGAGGAGG + Intergenic
1092427000 12:8382832-8382854 AGATCACGCTGTAGCAGAGGAGG - Intergenic
1093623078 12:21315263-21315285 TGAAGACTGAGTAGAAGTGGGGG - Intronic
1095967260 12:47877425-47877447 TTAACACTATGTAGCAGAGGGGG + Intronic
1100269610 12:93012143-93012165 TGAATAGGATGAAGAAGAGGAGG + Intergenic
1101697376 12:107139269-107139291 AGAACACAGTGTAGCAGAAGTGG + Intergenic
1102945840 12:116987219-116987241 AGAACACGGTCCAGAAGAGCTGG - Intronic
1103774094 12:123352760-123352782 AGACCACTGTGTAGAAGAGTGGG + Intronic
1103936230 12:124478469-124478491 GGAACACGGTGGGGCAGAGGGGG + Intronic
1104648893 12:130516937-130516959 TGACCACAGTGGAGAGGAGGGGG + Intronic
1107291463 13:38859239-38859261 GGAACAGAGTGTAGAACAGGTGG - Intronic
1108253976 13:48593331-48593353 TGAACAGGCTGAGGAAGAGGAGG + Intergenic
1108746099 13:53396151-53396173 TGAACACAATGTAGAAAAGAGGG + Intergenic
1110688326 13:78401734-78401756 TGGCCAGGGTGGAGAAGAGGGGG - Intergenic
1111192654 13:84830739-84830761 TGAACACGGGGTCGGGGAGGGGG + Intergenic
1120119494 14:80661234-80661256 TGAAAATGGAGCAGAAGAGGAGG - Intronic
1126063135 15:44803129-44803151 TGAAAACAGTATATAAGAGGAGG + Intergenic
1128061928 15:64740823-64740845 AGAACAAGGTGAGGAAGAGGAGG + Exonic
1132566809 16:627325-627347 TGAACACTGTGGGGCAGAGGGGG - Exonic
1133371258 16:5247533-5247555 AGATCACGCTGTAGCAGAGGAGG + Intergenic
1134741856 16:16554857-16554879 TGAGGACGGTGTAGAAGGAGGGG - Intergenic
1135682558 16:24470566-24470588 TGAATAGGGTGAAGAGGAGGAGG - Intergenic
1138695409 16:58808426-58808448 TGAAGAGGGGGAAGAAGAGGAGG - Intergenic
1141827416 16:86490579-86490601 TGAACACCGAGAAGAAGAGAAGG - Intergenic
1142226776 16:88881451-88881473 TGGACATGGTGGAGAAGACGCGG - Exonic
1144320216 17:14109757-14109779 TTGCCACGGTGTAGTAGAGGTGG + Intronic
1144421410 17:15102442-15102464 TGACCAGGGGCTAGAAGAGGTGG - Intergenic
1148127560 17:45244734-45244756 TGCACAAGGAGGAGAAGAGGTGG - Intronic
1151030899 17:70737676-70737698 TGAACACGTTGGAGAAAAGTAGG + Intergenic
1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG + Exonic
1153434053 18:5049412-5049434 GGAACCAGGGGTAGAAGAGGAGG + Intergenic
1155984439 18:32215144-32215166 GGAACTCAGTTTAGAAGAGGTGG + Exonic
1156521600 18:37726413-37726435 TAAACAGTGGGTAGAAGAGGAGG + Intergenic
1157242096 18:46020200-46020222 AGAACACTGTGGAGAAGAGAGGG - Intronic
1158762501 18:60406843-60406865 TGAATACTGTGTTGAACAGGAGG - Intergenic
1159966555 18:74600791-74600813 GGATCACGGAGTATAAGAGGAGG + Intronic
1160256287 18:77250881-77250903 TGGACACGGTGAAGAAGTAGTGG - Exonic
1163668361 19:18613449-18613471 GGAACACGATGTGGAGGAGGAGG - Intronic
1163983785 19:20925911-20925933 TGCACAGGGTGTAAAAGAAGTGG + Intronic
1164250093 19:23468470-23468492 AGAAAAAGGTGGAGAAGAGGAGG - Intergenic
1166990669 19:46690708-46690730 TGCACAGGGAGTAGAAGAGATGG + Intronic
1168053675 19:53848741-53848763 TGAACAGGGTACAGAAGACGAGG - Intergenic
1168251566 19:55145291-55145313 TGACCACGATGAAGAAGAAGGGG + Intronic
931331332 2:61287557-61287579 TGATCAGGAAGTAGAAGAGGAGG - Intronic
932386381 2:71337036-71337058 TGAACATGATGTAGAAAAGAAGG + Intronic
935036182 2:99376426-99376448 TGAAGAAAGTGAAGAAGAGGAGG + Exonic
937390811 2:121484660-121484682 AGAACATGGTGGGGAAGAGGTGG + Intronic
937506703 2:122545826-122545848 TGACCAAGATCTAGAAGAGGTGG + Intergenic
938754952 2:134371116-134371138 TGGACATGGTGTAGAGGAGTTGG + Intronic
939467612 2:142579065-142579087 TGAACAAAATGTAAAAGAGGTGG + Intergenic
940715829 2:157222687-157222709 TGTACATTGTTTAGAAGAGGTGG + Intergenic
940934740 2:159478663-159478685 TGAAGTTGGTGTAGTAGAGGAGG + Exonic
943127404 2:183811768-183811790 TGAACACGATGTGGAGTAGGGGG + Intergenic
947510619 2:230750369-230750391 TTAACATGGTGAAGAGGAGGTGG - Intronic
948786151 2:240354028-240354050 TGACCACGGTGCAGCAGAGGAGG - Intergenic
948896142 2:240928650-240928672 TGAACACGGAGTGCAGGAGGCGG + Intronic
949017403 2:241721076-241721098 TGGACTCGGCGCAGAAGAGGAGG + Intronic
1170152235 20:13237747-13237769 GGTACATGGTGTAGAAGAGATGG + Intronic
1171816207 20:29787870-29787892 TGCACAAGGGGTACAAGAGGGGG + Intergenic
1174098048 20:48105195-48105217 GGAGCACGGTGTAGAGGAGAGGG - Intergenic
1179942127 21:44647172-44647194 TGCACACGGGGTGGCAGAGGAGG - Exonic
950229100 3:11260429-11260451 TGCACAAGGGGTAGATGAGGGGG - Exonic
957071703 3:75572527-75572549 AGATCACGCTGTAGCAGAGGAGG - Intergenic
958700932 3:97588256-97588278 TGAACAAGGTGTAACAGAAGAGG + Intronic
959049097 3:101507444-101507466 TGAAGAAGATGTAGATGAGGGGG - Intronic
961282437 3:125774558-125774580 AGATCACGCTGTAGCAGAGGAGG + Intergenic
965046897 3:163589945-163589967 TTAGCACAGTGAAGAAGAGGTGG - Intergenic
965630382 3:170726714-170726736 GGTGCAGGGTGTAGAAGAGGAGG - Intronic
967079617 3:186037376-186037398 TGAACAAGGTGTATTAGAGTAGG + Intergenic
969738664 4:9008515-9008537 AGATCACGCTGTAGCAGAGGAGG + Intergenic
969797847 4:9540058-9540080 AGATCACGCTGTAGCAGAGGAGG + Intergenic
970672030 4:18407559-18407581 TGAACAGGGTTTAGGAGACGGGG + Intergenic
973915686 4:55632776-55632798 TGAACACAGTGAAGTTGAGGTGG - Intronic
979555866 4:122046719-122046741 TGAACACGTTGTTGAAGAGGAGG - Intergenic
986326300 5:6677578-6677600 GGAACACCGTGGAGAAGAGGTGG + Intergenic
988621710 5:32829982-32830004 TGATCAAGGTGGAGAAGAAGGGG + Intergenic
990267949 5:54098693-54098715 TGAAAACAGGGCAGAAGAGGAGG - Intronic
993392526 5:87338070-87338092 TGAAGACCTAGTAGAAGAGGTGG + Exonic
994294811 5:98078173-98078195 TGAATATGGGGTTGAAGAGGAGG + Intergenic
994664594 5:102692504-102692526 TGAAAAAGGTATAGAAGAAGGGG + Intergenic
995439830 5:112178068-112178090 TGTACACTGTTTACAAGAGGTGG + Intronic
998701006 5:144699753-144699775 GGAACAGAGTGTAAAAGAGGAGG - Intergenic
1002826277 6:777111-777133 TGAGGATGGTGTAGATGAGGAGG + Intergenic
1005148842 6:22724097-22724119 TGAATGCGAAGTAGAAGAGGGGG - Intergenic
1011941500 6:92848672-92848694 TGAAAAGGCTGTAGAAGAGATGG - Intergenic
1012366496 6:98447087-98447109 AGATCACCGTGTAGTAGAGGAGG - Intergenic
1013374516 6:109501450-109501472 TAAACAGGGAGTAGGAGAGGGGG + Intronic
1014743316 6:125170869-125170891 AGAACATGGTCTAGAAGAGGAGG - Intronic
1015089048 6:129331814-129331836 TGAATCCAGTATAGAAGAGGAGG - Intronic
1017073692 6:150599726-150599748 TGAAAAAGGTGGAGAGGAGGGGG - Intergenic
1021244533 7:18245409-18245431 TGAAGATGGAGGAGAAGAGGAGG - Intronic
1021530068 7:21634337-21634359 TGAATTCGGTGAACAAGAGGAGG + Intronic
1022978234 7:35577876-35577898 TGACAACGGCGAAGAAGAGGAGG + Intergenic
1023266016 7:38406657-38406679 GGAACACCAAGTAGAAGAGGGGG + Intronic
1023781360 7:43658889-43658911 TGAATGAGGTGTGGAAGAGGAGG + Intronic
1027403748 7:77836227-77836249 TGAATAGGTTGAAGAAGAGGAGG + Intronic
1030883917 7:114915856-114915878 TTAAAATGGTGTAGAAGATGAGG - Intergenic
1033440571 7:141374443-141374465 TGCACACAATGAAGAAGAGGTGG - Intronic
1036243743 8:7099797-7099819 AGATCACGCTGTAGCAGAGGAGG + Intergenic
1036898100 8:12651627-12651649 AGATCACGCTGTAGCAGAGGAGG - Intergenic
1039033654 8:33335867-33335889 TGAACAGGCTGAAGAGGAGGAGG + Intergenic
1041283762 8:56238703-56238725 TGAAGATGGTGTGGAAAAGGGGG + Intergenic
1045672748 8:104575073-104575095 GGAACATGGTGTGGGAGAGGGGG + Intronic
1047128799 8:121994605-121994627 TAAACACAGTGTAGAAGCAGAGG - Intergenic
1049103833 8:140598809-140598831 TGAAAACTTTGGAGAAGAGGTGG - Intronic
1055848980 9:80602426-80602448 AGAACACAGTGTTGGAGAGGCGG + Intergenic
1056244716 9:84682778-84682800 CGACCAAGATGTAGAAGAGGGGG - Intronic
1062514486 9:136925802-136925824 TGGAGACGGGGCAGAAGAGGGGG - Exonic
1189254726 X:39629108-39629130 TGACCACTGTGTGGCAGAGGGGG + Intergenic
1190148126 X:47917098-47917120 AGAACACAGTGCAGAACAGGAGG + Exonic
1195580499 X:106495571-106495593 TTAACACATTGTAGAAGACGGGG - Intergenic