ID: 1152604735 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:81283408-81283430 |
| Sequence | TGCCCGGCTGTTCGGGTTTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 115 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 26, 4: 88} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152604735_1152604745 | 26 | Left | 1152604735 | 17:81283408-81283430 | CCTGAAACCCGAACAGCCGGGCA | 0: 1 1: 0 2: 0 3: 26 4: 88 |
||
| Right | 1152604745 | 17:81283457-81283479 | CACGACGTAGAAGGCGATGCAGG | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||||
| 1152604735_1152604743 | 17 | Left | 1152604735 | 17:81283408-81283430 | CCTGAAACCCGAACAGCCGGGCA | 0: 1 1: 0 2: 0 3: 26 4: 88 |
||
| Right | 1152604743 | 17:81283448-81283470 | GTCGCCGATCACGACGTAGAAGG | 0: 1 1: 0 2: 0 3: 1 4: 6 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152604735 | Original CRISPR | TGCCCGGCTGTTCGGGTTTC AGG (reversed) | Exonic | ||