ID: 1152604735

View in Genome Browser
Species Human (GRCh38)
Location 17:81283408-81283430
Sequence TGCCCGGCTGTTCGGGTTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604735_1152604745 26 Left 1152604735 17:81283408-81283430 CCTGAAACCCGAACAGCCGGGCA 0: 1
1: 0
2: 0
3: 26
4: 88
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604735_1152604743 17 Left 1152604735 17:81283408-81283430 CCTGAAACCCGAACAGCCGGGCA 0: 1
1: 0
2: 0
3: 26
4: 88
Right 1152604743 17:81283448-81283470 GTCGCCGATCACGACGTAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604735 Original CRISPR TGCCCGGCTGTTCGGGTTTC AGG (reversed) Exonic