ID: 1152604736

View in Genome Browser
Species Human (GRCh38)
Location 17:81283415-81283437
Sequence ACTTCTTTGCCCGGCTGTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604736_1152604743 10 Left 1152604736 17:81283415-81283437 CCCGAACAGCCGGGCAAAGAAGT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1152604743 17:81283448-81283470 GTCGCCGATCACGACGTAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 6
1152604736_1152604745 19 Left 1152604736 17:81283415-81283437 CCCGAACAGCCGGGCAAAGAAGT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604736 Original CRISPR ACTTCTTTGCCCGGCTGTTC GGG (reversed) Exonic