ID: 1152604737

View in Genome Browser
Species Human (GRCh38)
Location 17:81283416-81283438
Sequence AACTTCTTTGCCCGGCTGTT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604737_1152604743 9 Left 1152604737 17:81283416-81283438 CCGAACAGCCGGGCAAAGAAGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1152604743 17:81283448-81283470 GTCGCCGATCACGACGTAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 6
1152604737_1152604745 18 Left 1152604737 17:81283416-81283438 CCGAACAGCCGGGCAAAGAAGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604737 Original CRISPR AACTTCTTTGCCCGGCTGTT CGG (reversed) Exonic