ID: 1152604739 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:81283424-81283446 |
Sequence | TGGGGTCCAACTTCTTTGCC CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 163 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 149} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152604739_1152604743 | 1 | Left | 1152604739 | 17:81283424-81283446 | CCGGGCAAAGAAGTTGGACCCCA | 0: 1 1: 0 2: 0 3: 13 4: 149 |
||
Right | 1152604743 | 17:81283448-81283470 | GTCGCCGATCACGACGTAGAAGG | 0: 1 1: 0 2: 0 3: 1 4: 6 |
||||
1152604739_1152604745 | 10 | Left | 1152604739 | 17:81283424-81283446 | CCGGGCAAAGAAGTTGGACCCCA | 0: 1 1: 0 2: 0 3: 13 4: 149 |
||
Right | 1152604745 | 17:81283457-81283479 | CACGACGTAGAAGGCGATGCAGG | 0: 1 1: 0 2: 0 3: 1 4: 24 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152604739 | Original CRISPR | TGGGGTCCAACTTCTTTGCC CGG (reversed) | Exonic | ||