ID: 1152604741

View in Genome Browser
Species Human (GRCh38)
Location 17:81283443-81283465
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 7}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604741_1152604752 28 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604741_1152604754 30 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604754 17:81283496-81283518 GATCATGCTGCACAGGGACGGGG 0: 1
1: 0
2: 1
3: 6
4: 89
1152604741_1152604753 29 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604741_1152604745 -9 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604741_1152604749 24 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604741_1152604748 23 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604741 Original CRISPR TACGTCGTGATCGGCGACTT GGG (reversed) Exonic