ID: 1152604742

View in Genome Browser
Species Human (GRCh38)
Location 17:81283444-81283466
Sequence CTACGTCGTGATCGGCGACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 3}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604742_1152604748 22 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1152604742_1152604745 -10 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604742_1152604753 28 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604742_1152604749 23 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604742_1152604752 27 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604742_1152604754 29 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604754 17:81283496-81283518 GATCATGCTGCACAGGGACGGGG 0: 1
1: 0
2: 1
3: 6
4: 89
1152604742_1152604755 30 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604755 17:81283497-81283519 ATCATGCTGCACAGGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604742 Original CRISPR CTACGTCGTGATCGGCGACT TGG (reversed) Exonic