ID: 1152604744

View in Genome Browser
Species Human (GRCh38)
Location 17:81283452-81283474
Sequence ATCGCCTTCTACGTCGTGAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 11}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604744_1152604756 23 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604756 17:81283498-81283520 TCATGCTGCACAGGGACGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 139
1152604744_1152604752 19 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604744_1152604754 21 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604754 17:81283496-81283518 GATCATGCTGCACAGGGACGGGG 0: 1
1: 0
2: 1
3: 6
4: 89
1152604744_1152604748 14 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1152604744_1152604757 28 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604757 17:81283503-81283525 CTGCACAGGGACGGGGGGTACGG 0: 1
1: 0
2: 1
3: 8
4: 241
1152604744_1152604749 15 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604744_1152604753 20 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604744_1152604755 22 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604755 17:81283497-81283519 ATCATGCTGCACAGGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 123
1152604744_1152604758 29 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604758 17:81283504-81283526 TGCACAGGGACGGGGGGTACGGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604744 Original CRISPR ATCGCCTTCTACGTCGTGAT CGG (reversed) Exonic