ID: 1152604745

View in Genome Browser
Species Human (GRCh38)
Location 17:81283457-81283479
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604741_1152604745 -9 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604735_1152604745 26 Left 1152604735 17:81283408-81283430 CCTGAAACCCGAACAGCCGGGCA 0: 1
1: 0
2: 0
3: 26
4: 88
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604737_1152604745 18 Left 1152604737 17:81283416-81283438 CCGAACAGCCGGGCAAAGAAGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604736_1152604745 19 Left 1152604736 17:81283415-81283437 CCCGAACAGCCGGGCAAAGAAGT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604739_1152604745 10 Left 1152604739 17:81283424-81283446 CCGGGCAAAGAAGTTGGACCCCA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604742_1152604745 -10 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152604740_1152604745 -8 Left 1152604740 17:81283442-81283464 CCCCAAGTCGCCGATCACGACGT 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604745 17:81283457-81283479 CACGACGTAGAAGGCGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type