ID: 1152604748

View in Genome Browser
Species Human (GRCh38)
Location 17:81283489-81283511
Sequence TCAGCCCGATCATGCTGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604741_1152604748 23 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1152604742_1152604748 22 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1152604740_1152604748 24 Left 1152604740 17:81283442-81283464 CCCCAAGTCGCCGATCACGACGT 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1152604744_1152604748 14 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604748 17:81283489-81283511 TCAGCCCGATCATGCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604748 Original CRISPR TCAGCCCGATCATGCTGCAC AGG Exonic