ID: 1152604749

View in Genome Browser
Species Human (GRCh38)
Location 17:81283490-81283512
Sequence CAGCCCGATCATGCTGCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604740_1152604749 25 Left 1152604740 17:81283442-81283464 CCCCAAGTCGCCGATCACGACGT 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604741_1152604749 24 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604742_1152604749 23 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1152604744_1152604749 15 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604749 17:81283490-81283512 CAGCCCGATCATGCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604749 Original CRISPR CAGCCCGATCATGCTGCACA GGG Exonic