ID: 1152604752

View in Genome Browser
Species Human (GRCh38)
Location 17:81283494-81283516
Sequence CCGATCATGCTGCACAGGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604741_1152604752 28 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604744_1152604752 19 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604742_1152604752 27 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86
1152604740_1152604752 29 Left 1152604740 17:81283442-81283464 CCCCAAGTCGCCGATCACGACGT 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG 0: 1
1: 0
2: 1
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604752 Original CRISPR CCGATCATGCTGCACAGGGA CGG Exonic
902933280 1:19746125-19746147 CAGGTGATGCTGCTCAGGGAAGG + Intronic
903057238 1:20644736-20644758 CTGATCAAGGTGCACATGGAGGG - Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
913530161 1:119728243-119728265 CCTATCCTGCCTCACAGGGAGGG + Intronic
915910159 1:159910039-159910061 CCGTGCATGCGGCACAGAGAGGG + Intergenic
916689607 1:167177895-167177917 CCAATATTGCTGCAAAGGGACGG - Intergenic
920956804 1:210627086-210627108 CCCATCAAGGTGCAGAGGGAAGG - Intronic
922071283 1:222196394-222196416 CAGATAATGCTGCTCAGGGCAGG - Intergenic
1065839104 10:29685792-29685814 CAGATCATGATGGAAAGGGAGGG - Intronic
1068257913 10:54537751-54537773 CTGGTAATGCTGCACAGAGAAGG - Intronic
1070675594 10:78409391-78409413 CCATTCATGCTGCACAGGGATGG + Intergenic
1070857226 10:79615601-79615623 ACTATGATGCTGCAGAGGGATGG + Intergenic
1070967438 10:80538190-80538212 CTGACAATGCTGCACAGAGAAGG + Exonic
1072130828 10:92492389-92492411 CTGATAGTGCTACACAGGGATGG - Intronic
1077222025 11:1422054-1422076 CCGATGATGCAGCCCAGGCACGG - Intronic
1088671973 11:112150568-112150590 GAGATCCAGCTGCACAGGGAAGG - Intronic
1089730096 11:120513839-120513861 CCGATCAAGATGCCCAGGTAGGG - Intronic
1090956851 11:131520956-131520978 CCGATCATGATGGAAGGGGAAGG + Intronic
1091137950 11:133209509-133209531 CCTATCATTCTTCAGAGGGAAGG + Intronic
1095778580 12:46035039-46035061 CCGAGCTTGATGCATAGGGAAGG - Intergenic
1096124448 12:49109477-49109499 CCAATCAGGCTGCCCAGGGCTGG + Intronic
1101652827 12:106693315-106693337 CTGTTCAAGCTGCACTGGGAAGG - Intronic
1104124550 12:125833779-125833801 CCAATCATGGTGGAAAGGGAAGG - Intergenic
1113793845 13:113045397-113045419 GCGGTCATGCAGCCCAGGGAGGG - Intronic
1117265217 14:54079486-54079508 GGGATGATGCTGTACAGGGATGG - Intergenic
1120383697 14:83816906-83816928 CTAATCCTGCTGCACAGGAATGG + Intergenic
1120840160 14:89078512-89078534 TCGATCTTGCCTCACAGGGAAGG - Intergenic
1121644067 14:95505917-95505939 GTGATCCTGATGCACAGGGATGG - Intergenic
1121876272 14:97456404-97456426 CAGAGCAGGCTGCACAGGCATGG + Intergenic
1122481587 14:102050844-102050866 CCTTCCATGCTGCCCAGGGAGGG + Intergenic
1122804008 14:104247647-104247669 CGGCTCAGGCTGCCCAGGGAGGG - Intergenic
1122921813 14:104883424-104883446 CCGAGCCTGCTGCACCGGGTTGG + Exonic
1123105859 14:105840781-105840803 CCGGTCATCCTCCACAGGAAAGG - Intergenic
1124355101 15:28989584-28989606 CCGTTCAGGCAGCTCAGGGATGG - Intronic
1131219203 15:90567210-90567232 CCACTCATACTGCACAGGCAGGG - Intronic
1131284491 15:91045789-91045811 CCCATTGTGCTGCACAGGCAGGG - Intergenic
1132502636 16:291364-291386 CCAATGCTGCTGCGCAGGGACGG + Intronic
1132650762 16:1020588-1020610 GCGGTCCTGGTGCACAGGGAGGG + Intergenic
1135498167 16:22970658-22970680 CAGACCATGATCCACAGGGAGGG - Intergenic
1139783815 16:69374032-69374054 CAGTTCTTGCTGCACAGGGAAGG + Intronic
1141126406 16:81403969-81403991 CTGCTCATGCTGCAAATGGAGGG - Intergenic
1142428511 16:90013440-90013462 CCCAGCATGCAGCACAGGGCTGG + Intronic
1152292398 17:79447565-79447587 CCCAAGATGCAGCACAGGGAGGG + Intronic
1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG + Exonic
1155224052 18:23712922-23712944 AGGATCATGCTTCCCAGGGATGG - Intronic
1161726598 19:5932990-5933012 CCGGGGATGCTGCACAGGGCAGG - Intronic
1162908365 19:13836551-13836573 CCGAGGATGCTGCCCGGGGACGG - Intergenic
1163737919 19:18992799-18992821 ACGATCCTGCTTCACAAGGAAGG + Exonic
1168554688 19:57328097-57328119 CCGTTCATGCTGAACAAGGAGGG - Exonic
926174158 2:10574174-10574196 CCTAGCATGCAGCACAGGGCAGG + Intronic
927019964 2:19006281-19006303 CTGATTCTGCTGCCCAGGGAGGG - Intergenic
931288826 2:60854765-60854787 CCTATCATGCTTCTCAGGCAGGG + Intergenic
934518690 2:95005843-95005865 CTGACCCTGCTGCCCAGGGAAGG - Intergenic
937103098 2:119286642-119286664 CCGATGGTTCTGAACAGGGAGGG + Intergenic
939730405 2:145777571-145777593 CTCATCATGCTGGACATGGAGGG - Intergenic
943336740 2:186624317-186624339 CTAATTATGCTGCATAGGGAAGG + Intronic
946899823 2:224361537-224361559 CCTATCATACTGCACAGGTTGGG - Intergenic
1175992680 20:62797245-62797267 CCCATCGGGCGGCACAGGGAGGG - Intronic
1178909533 21:36663451-36663473 CAGAACACGCTCCACAGGGAAGG + Intergenic
1179477034 21:41653615-41653637 CCCAGCAGGCTGCCCAGGGAAGG + Intergenic
1183168541 22:36166522-36166544 CCAATAATCCTGCACTGGGATGG - Intergenic
1184191632 22:42898851-42898873 CGGATGTTTCTGCACAGGGATGG - Intronic
949911988 3:8918781-8918803 CTGATAATACTGCACAGGGCAGG - Intronic
952452987 3:33448820-33448842 CCCTTCAAGCTGTACAGGGAGGG + Intergenic
953694418 3:45146416-45146438 GCGATCCTGCTGCGCAGGGCGGG - Exonic
953955399 3:47227941-47227963 CCGTGCATGCTGCGTAGGGAAGG + Intergenic
955963090 3:64361160-64361182 CCCAACATGCTGCACTGAGAAGG + Intronic
958575849 3:95949399-95949421 CCCTTCAAGCTGCAGAGGGAGGG - Intergenic
958666935 3:97152846-97152868 ACGAAAATGCTGCTCAGGGATGG - Intronic
960820189 3:121722256-121722278 CAGAGCAAGCTGCACAGGTAGGG - Exonic
961009957 3:123429193-123429215 CCGAACATTCTGCAAAGGCAGGG + Intronic
961402804 3:126658907-126658929 CCTCTCATGCTGCACAGGATAGG - Intergenic
967488112 3:190057649-190057671 AGGATCATCCTGCAGAGGGAAGG + Intronic
971043603 4:22780961-22780983 TCGCTCATGCTTCACAGAGAAGG + Intergenic
979230589 4:118344993-118345015 CAGATCATGCACCACAGGGAAGG + Intronic
981850085 4:149219287-149219309 CTGCTCATGGGGCACAGGGAAGG + Intergenic
985391977 4:189499663-189499685 CAGGTCATTCTGCACAGAGAAGG + Intergenic
1001465686 5:171963654-171963676 CAGATCATGCAACACAGAGATGG + Intronic
1006350753 6:33519434-33519456 CCAATCATCCTGCATTGGGATGG - Intergenic
1012425975 6:99114903-99114925 CAGACTATGATGCACAGGGAAGG - Intergenic
1019596163 7:1859373-1859395 CAACTCATTCTGCACAGGGAAGG + Intronic
1022967542 7:35487440-35487462 CAGATAATGCAGCTCAGGGAGGG + Intergenic
1026493623 7:70884237-70884259 CAGATAAGGCTGCACAGGGAGGG + Intergenic
1034225314 7:149476961-149476983 CCGAGCATGCTGAAGAGGGATGG + Exonic
1035662096 8:1356008-1356030 CCGATCATGCAAGGCAGGGAGGG - Intergenic
1041706139 8:60848286-60848308 CCGCTCACACTGCACAGAGAGGG - Intronic
1050122114 9:2318002-2318024 CATACCATGCTGCAGAGGGAGGG + Intergenic
1052625683 9:30973752-30973774 CCGAACATGATGCACAGCTAAGG - Intergenic
1052930153 9:34049312-34049334 CCCAACATGCTGCACAGCCAAGG + Intergenic
1055934225 9:81589992-81590014 CCTCTCATGCTGCACAGAGAAGG - Intronic
1056805102 9:89722226-89722248 CTGATTCTGCTGCCCAGGGAGGG + Intergenic
1057255683 9:93545257-93545279 TCCCTCATGCTGCACTGGGAGGG - Intronic
1187670267 X:21659110-21659132 TTGTTCATGCTGCAAAGGGATGG - Intergenic
1195645610 X:107227544-107227566 CAGACCATGTGGCACAGGGAAGG + Intronic