ID: 1152604753

View in Genome Browser
Species Human (GRCh38)
Location 17:81283495-81283517
Sequence CGATCATGCTGCACAGGGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152604740_1152604753 30 Left 1152604740 17:81283442-81283464 CCCCAAGTCGCCGATCACGACGT 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604746_1152604753 -10 Left 1152604746 17:81283482-81283504 CCCAGCATCAGCCCGATCATGCT 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604744_1152604753 20 Left 1152604744 17:81283452-81283474 CCGATCACGACGTAGAAGGCGAT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604741_1152604753 29 Left 1152604741 17:81283443-81283465 CCCAAGTCGCCGATCACGACGTA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1152604742_1152604753 28 Left 1152604742 17:81283444-81283466 CCAAGTCGCCGATCACGACGTAG 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1152604753 17:81283495-81283517 CGATCATGCTGCACAGGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152604753 Original CRISPR CGATCATGCTGCACAGGGAC GGG Exonic