ID: 1152606214

View in Genome Browser
Species Human (GRCh38)
Location 17:81291898-81291920
Sequence TGACCCCTAGTGTGCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152606214_1152606219 5 Left 1152606214 17:81291898-81291920 CCACCGTGGCACACTAGGGGTCA 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1152606219 17:81291926-81291948 GTGCCCCGGGTAGGCCGCCACGG 0: 1
1: 0
2: 0
3: 7
4: 71
1152606214_1152606226 30 Left 1152606214 17:81291898-81291920 CCACCGTGGCACACTAGGGGTCA 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1152606226 17:81291951-81291973 ACAGAGTACGCTCCTTAATTTGG 0: 1
1: 0
2: 0
3: 4
4: 60
1152606214_1152606216 -9 Left 1152606214 17:81291898-81291920 CCACCGTGGCACACTAGGGGTCA 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1152606216 17:81291912-81291934 TAGGGGTCAGCAGTGTGCCCCGG 0: 1
1: 0
2: 1
3: 16
4: 171
1152606214_1152606217 -8 Left 1152606214 17:81291898-81291920 CCACCGTGGCACACTAGGGGTCA 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1152606217 17:81291913-81291935 AGGGGTCAGCAGTGTGCCCCGGG 0: 1
1: 1
2: 0
3: 26
4: 271
1152606214_1152606218 -4 Left 1152606214 17:81291898-81291920 CCACCGTGGCACACTAGGGGTCA 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1152606218 17:81291917-81291939 GTCAGCAGTGTGCCCCGGGTAGG 0: 1
1: 1
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152606214 Original CRISPR TGACCCCTAGTGTGCCACGG TGG (reversed) Intronic
900805200 1:4763048-4763070 TCACCCCCAGTGTGCCTCAGAGG - Intronic
902465756 1:16617354-16617376 GGACCCCACGGGTGCCACGGTGG - Intergenic
906178781 1:43800071-43800093 TGGCCCCCAGTATGCCACGTTGG + Intronic
906256882 1:44357147-44357169 TGAGCCCTAGTGCACCAAGGAGG - Intergenic
907243854 1:53094840-53094862 GGAACCCTAGTGTGGCACGGGGG + Intronic
920969610 1:210731991-210732013 TGAGGCCCAGTGTGCCACAGAGG + Intronic
921506865 1:215982483-215982505 TGACAGATAGTGTGCCACGGAGG - Intronic
1066632530 10:37470951-37470973 TGACACCTAGCTTGCCATGGTGG + Intergenic
1067082464 10:43219357-43219379 AGACCCCTAGGGTGCCACGGAGG + Intronic
1067684419 10:48458121-48458143 TGACCCCCATACTGCCACGGTGG - Intronic
1069047789 10:63761482-63761504 TGACCTCTAGAGAGCCACAGGGG + Intergenic
1075213176 10:120508983-120509005 TGACCCCTTGTAGGCCACTGTGG - Intronic
1078465026 11:11543778-11543800 GGGCCCCGAATGTGCCACGGTGG + Intronic
1090846261 11:130532484-130532506 TGACCCCTAGTGTTAAAGGGGGG + Intergenic
1090846281 11:130532575-130532597 TGACCCCTAGTGTTAAAGGGGGG + Intergenic
1090846301 11:130532666-130532688 TGACCCCTAGTGTTAAAGGGGGG + Intergenic
1105443428 13:20433887-20433909 TGACCCCCAGTCTGCCACAGTGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122529444 14:102415599-102415621 TGACCCCTCCTATGCCAAGGAGG + Intronic
1123056820 14:105574761-105574783 TGACACATAGTGTGCCCCGATGG + Intergenic
1123081390 14:105697024-105697046 TGACACATAGTGTGCCCCGATGG - Intergenic
1123940498 15:25214331-25214353 TGACCCCTGTGGTGCCCCGGAGG - Intergenic
1130913991 15:88290665-88290687 TGACCTCTAGTCTGCCTGGGTGG + Intergenic
1141561378 16:84870019-84870041 TCAGCCCCAGTGTGCCACTGTGG + Intronic
1144847341 17:18226718-18226740 TGGCCCCTAGTGTCCCACTCCGG - Intronic
1147726176 17:42567310-42567332 TCACCCCGCGTGTGCCAAGGTGG + Exonic
1148757278 17:49980165-49980187 TGCCCCCTAGGGTGCCAGTGGGG - Intergenic
1151799543 17:76369857-76369879 TGGCCCCTTGTGTGACATGGCGG - Intronic
1152606214 17:81291898-81291920 TGACCCCTAGTGTGCCACGGTGG - Intronic
1155444475 18:25896380-25896402 TGACCCCTAGTGGGCACCAGTGG + Intergenic
925167585 2:1727648-1727670 TGACCTGTGGTGTGACACGGTGG - Intronic
928738270 2:34318763-34318785 TGACCTCTGCTGTGCCACTGAGG - Intergenic
1169201097 20:3710587-3710609 TGACCCCCAGTGTGCCCAGCAGG - Intergenic
1170586353 20:17737218-17737240 TGAGCCCTAGTTTCCCACAGCGG + Intergenic
1170827331 20:19808314-19808336 TGACTCCTACTGGGCCATGGCGG - Intergenic
1172707262 20:36891386-36891408 TCACTCCCAGTGTGCCAGGGAGG + Exonic
1173396625 20:42686353-42686375 TGACCCCTAGTGGGACAATGGGG + Intronic
1181643349 22:24216486-24216508 TCACCCCAAATGTGCCACAGAGG - Intergenic
1185206486 22:49541825-49541847 TGACCCCTAGGCTGCCAGGTGGG + Intronic
954700964 3:52450777-52450799 GGACCCCTAGGCTGCCACAGTGG + Intergenic
955493741 3:59509388-59509410 TGACCCCAAGTGAGCCAGAGAGG - Intergenic
959066979 3:101667359-101667381 TGACACCTAGTGTGAGAAGGCGG - Intronic
963170386 3:142244229-142244251 TGATCCCCAGTGTGCCACTTTGG + Intergenic
964975217 3:162610362-162610384 TGACCCCTTGTGTACCATGTGGG - Intergenic
975459466 4:74633832-74633854 TCACCCATAGTCTGCCATGGTGG + Intergenic
999196137 5:149782875-149782897 TGACCCCCAGTGGGCCTCTGAGG + Intronic
1009768150 6:68108499-68108521 TGCTCCCAAGTGTTCCACGGAGG + Intergenic
1013412504 6:109894139-109894161 TGACCTCAGGTGTGCCAAGGGGG - Intergenic
1014152211 6:118070357-118070379 TCACACCTACTGTGCCACAGAGG - Intronic
1024499870 7:50093323-50093345 TGACCCCTAGTCTACCACCCCGG - Intronic
1024569174 7:50709919-50709941 TGGCTCCTAGAGTGCCATGGAGG - Intronic
1029933397 7:104397549-104397571 TTACCCCTAGTTTCCCCCGGGGG + Intronic
1034182428 7:149148525-149148547 TCACCCCTCATGTGCCAGGGTGG - Intronic
1035517729 8:250766-250788 TGACCCCTGGTGAGTCAAGGGGG + Intergenic
1036715297 8:11117197-11117219 TCACCCCTAGTGTATCATGGGGG - Intronic
1037881853 8:22577392-22577414 TGTCCCCTTCTGTGCCACAGAGG + Intergenic
1040561365 8:48525805-48525827 TGCCCCCTAGGTTGTCACGGGGG + Intergenic
1049423702 8:142527964-142527986 TCACCCTGTGTGTGCCACGGGGG + Intronic
1049578924 8:143402063-143402085 TCACCCCAGGTGTGCCACGTGGG + Intergenic
1055907649 9:81312512-81312534 TGACCTCTAGTGTGAAACGATGG - Intergenic
1056850917 9:90082708-90082730 TGACCCCTACTGAGCCAGGCTGG - Intergenic
1061842848 9:133369741-133369763 TGGCACATCGTGTGCCACGGTGG - Intronic
1186416804 X:9390759-9390781 TGACCCCTAATGTCCCACATAGG - Intergenic
1193740710 X:85214413-85214435 TGAGGCCTAGTGTGTCATGGTGG - Intergenic