ID: 1152606778

View in Genome Browser
Species Human (GRCh38)
Location 17:81295363-81295385
Sequence GACGCGAGCCAATGAGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152606768_1152606778 12 Left 1152606768 17:81295328-81295350 CCCGGAAGTGACGGCCAGGGGGT 0: 1
1: 0
2: 4
3: 11
4: 130
Right 1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1152606775_1152606778 -2 Left 1152606775 17:81295342-81295364 CCAGGGGGTAGGGTTTGGTGGGA 0: 1
1: 0
2: 2
3: 28
4: 272
Right 1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1152606769_1152606778 11 Left 1152606769 17:81295329-81295351 CCGGAAGTGACGGCCAGGGGGTA 0: 1
1: 2
2: 0
3: 7
4: 50
Right 1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1152606763_1152606778 18 Left 1152606763 17:81295322-81295344 CCGTTGCCCGGAAGTGACGGCCA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1152606761_1152606778 27 Left 1152606761 17:81295313-81295335 CCACGGGCTCCGTTGCCCGGAAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152606778 Original CRISPR GACGCGAGCCAATGAGAGGC GGG Intronic
901774260 1:11548776-11548798 GACTCCAGCCAAGGAGAGCCAGG - Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
913328879 1:117650991-117651013 GCAGAGAGCCAATGAGATGCGGG - Intergenic
913450315 1:118988418-118988440 AGCGCGAACCAATGAGAGGAAGG + Intronic
914226206 1:145721270-145721292 GACGCGGGCCAACGCGGGGCAGG + Intronic
917494772 1:175530341-175530363 GCCCAGAGCCAAAGAGAGGCGGG - Intronic
920703262 1:208233636-208233658 GCTGCGAGGGAATGAGAGGCAGG - Intronic
923079403 1:230639734-230639756 GACACTAGCCAATCAGAAGCTGG + Intergenic
923169105 1:231396546-231396568 GACAGAAGCCAATGAGGGGCCGG - Intronic
1065343257 10:24724746-24724768 AACGCGAACCAATCAGGGGCTGG + Intergenic
1067556617 10:47277611-47277633 GACCAGAGCCAGGGAGAGGCAGG - Intergenic
1068611048 10:59060747-59060769 GAGGCCAGCCAAGGAGAGGGAGG + Intergenic
1072898885 10:99390180-99390202 GACGTGAGCCAAGGTGAGGGTGG - Intronic
1075701149 10:124470137-124470159 GAGGGGAGCCATTCAGAGGCAGG + Intronic
1076547158 10:131253089-131253111 GCCAAGAGCCCATGAGAGGCTGG - Intronic
1077718982 11:4608247-4608269 GACGGCAGCCAATGAGCGGCCGG + Exonic
1089395860 11:118136047-118136069 GGAGCGAGCCAATGGGAGGTTGG + Exonic
1091230074 11:133982431-133982453 GACGCGAGCCCAGGGCAGGCAGG + Intergenic
1091923026 12:4321016-4321038 GCCGCGCGCCAATCACAGGCCGG + Intergenic
1092533703 12:9366651-9366673 GACAGAAGCCAAGGAGAGGCCGG - Intergenic
1109888732 13:68578957-68578979 GAACCCAACCAATGAGAGGCTGG + Intergenic
1114948592 14:27717451-27717473 GACGAGAGCAGATGAGAAGCAGG - Intergenic
1119796704 14:77404694-77404716 GAAGCTAGCCAAGGAGGGGCCGG + Intronic
1127147276 15:56036975-56036997 GATGAGAGCAAAGGAGAGGCTGG - Intergenic
1133073854 16:3264552-3264574 CACGCGAGCCAATTGGAGGGCGG + Intronic
1136272547 16:29157177-29157199 GCCCCAAGACAATGAGAGGCAGG + Intergenic
1142076103 16:88118986-88119008 GCCCCAAGACAATGAGAGGCAGG + Intergenic
1142347080 16:89560907-89560929 GAGGGGAGCGAGTGAGAGGCCGG - Intronic
1143091778 17:4453153-4453175 GACGAGAGCCAGGTAGAGGCAGG - Exonic
1147970992 17:44219109-44219131 GAGCCGAGCCAAGGAGAGGGCGG + Intronic
1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG + Intronic
1152729099 17:81961175-81961197 GGCCCGCGCCAATGAGCGGCGGG + Exonic
1153719745 18:7889758-7889780 GAGACGAGCCAGTGAGGGGCAGG + Intronic
1155733449 18:29191302-29191324 GACACTAGCAGATGAGAGGCAGG + Intergenic
1160830715 19:1103879-1103901 GACGTCAGCCAATGGGAGGCCGG - Intergenic
1161103559 19:2432889-2432911 GCCGCCGGCCAATGCGAGGCAGG - Intronic
1161103594 19:2432993-2433015 GCCGCCGGCCAATGCGAGGCAGG - Intronic
1161103628 19:2433098-2433120 GCCGCCGGCCAATGCGAGGCAGG - Intronic
1168267763 19:55231712-55231734 CACTCGAGCCTATGAGAGGACGG + Intronic
927192581 2:20526897-20526919 GAGTTGAGCCAAGGAGAGGCAGG - Intergenic
927336421 2:21929977-21929999 GAAGCAAGACAAAGAGAGGCAGG - Intergenic
929691463 2:44077916-44077938 GACGCAAGCAAATAAGAGTCAGG + Intergenic
931643362 2:64400620-64400642 GACGGGATGCAAAGAGAGGCAGG - Intergenic
934685624 2:96319333-96319355 GACCCGATACAATGAGAGTCTGG - Intergenic
945989208 2:216379660-216379682 GAGGCAAGGCAACGAGAGGCGGG + Intergenic
946861375 2:224003019-224003041 GATGCGAGCAGATGAGGGGCCGG + Intronic
948992252 2:241561085-241561107 GAGCAGAGCCCATGAGAGGCTGG - Intronic
1172003279 20:31798414-31798436 GAAGAGAGCCAAAGAGCGGCAGG + Exonic
1180110113 21:45643565-45643587 GCCGCGGGCCAATGAAAGGGCGG - Intergenic
1182483928 22:30627918-30627940 GCCCCCAACCAATGAGAGGCAGG - Intergenic
1183205667 22:36417292-36417314 GACGAGATCAAATGAGAGCCTGG - Intergenic
951470619 3:23052318-23052340 AAGGCTAGCCAATAAGAGGCCGG + Intergenic
960664116 3:120094019-120094041 GTCGCGAGTCAGTCAGAGGCGGG + Intronic
962413440 3:135161594-135161616 GAAGCAAGACAAAGAGAGGCAGG + Intronic
962551959 3:136502654-136502676 GAAGAGAGCCAATGAAAGGTTGG - Exonic
984348800 4:178565626-178565648 GAGTGGAGCCAATGAGAGGCTGG + Intergenic
984923378 4:184785384-184785406 GATGAGAGCCACTGAGAAGCAGG + Intronic
998159640 5:139806196-139806218 GACGCCTGCAAATGACAGGCTGG - Intronic
1000328193 5:160188029-160188051 GACGTGAGCCACTGAGACCCCGG + Intronic
1001587656 5:172844462-172844484 GACGATAGCCTATGACAGGCAGG + Intronic
1014599719 6:123395593-123395615 GACGCGGGACAATGAGGGGCAGG - Intronic
1018983574 6:168618320-168618342 GAGGCGAGTCAAGGAGAGGCAGG + Intronic
1019574113 7:1728045-1728067 GTCCAGAGCCATTGAGAGGCAGG + Intronic
1023029534 7:36080251-36080273 AACAGGAGCCAAAGAGAGGCTGG - Intronic
1027264168 7:76484806-76484828 GACACGAACCAATGAGCGGGAGG - Intronic
1027315537 7:76982920-76982942 GACACGAACCAATGAGCGGGAGG - Intergenic
1028774077 7:94658234-94658256 GAGGCGGGCCCAGGAGAGGCGGG - Intronic
1028774106 7:94658324-94658346 GAGGCGGGCCCAGGAGAGGCGGG - Intronic
1028774121 7:94658369-94658391 GAGGCGGGCCCAGGAGAGGCGGG - Intronic
1035638507 8:1164457-1164479 GACGTCAGCCAGTGAGAGCCAGG - Intergenic
1052852656 9:33387291-33387313 GACCTGAGCCACTGAGAGCCGGG + Intronic
1053680756 9:40483842-40483864 GACCTGAGCCACTGAGAGCCGGG + Intergenic
1053930741 9:43112154-43112176 GACCTGAGCCACTGAGAGCCGGG + Intergenic
1054282957 9:63141093-63141115 GACCTGAGCCACTGAGAGCCGGG - Intergenic
1054293838 9:63319357-63319379 GACCTGAGCCACTGAGAGCCGGG + Intergenic
1054391862 9:64623846-64623868 GACCTGAGCCACTGAGAGCCGGG + Intergenic
1054503867 9:65892482-65892504 GACCTGAGCCACTGAGAGCCGGG - Intronic
1055553443 9:77452085-77452107 GACACGATCCAGTAAGAGGCTGG + Intronic
1190070549 X:47275827-47275849 GAGGCGAGGCAAGGCGAGGCGGG - Intergenic
1190598536 X:52068239-52068261 GGCGGGATCCAATGGGAGGCGGG + Intronic
1190610288 X:52185834-52185856 GGCGGGATCCAATGGGAGGCGGG - Intronic