ID: 1152608559

View in Genome Browser
Species Human (GRCh38)
Location 17:81304830-81304852
Sequence CGGCAGAGGGCAGACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152608559_1152608569 6 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608569 17:81304859-81304881 GCGGCATCCCCCAGCCCCAAGGG 0: 1
1: 0
2: 1
3: 20
4: 167
1152608559_1152608577 20 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608577 17:81304873-81304895 CCCCAAGGGCGGTGGTCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 157
1152608559_1152608570 9 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608570 17:81304862-81304884 GCATCCCCCAGCCCCAAGGGCGG 0: 1
1: 0
2: 3
3: 42
4: 305
1152608559_1152608580 28 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608580 17:81304881-81304903 GCGGTGGTCCCATGGCCAGACGG 0: 1
1: 0
2: 0
3: 11
4: 96
1152608559_1152608571 12 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608571 17:81304865-81304887 TCCCCCAGCCCCAAGGGCGGTGG 0: 1
1: 0
2: 2
3: 27
4: 396
1152608559_1152608568 5 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608568 17:81304858-81304880 TGCGGCATCCCCCAGCCCCAAGG 0: 1
1: 0
2: 0
3: 43
4: 255
1152608559_1152608581 29 Left 1152608559 17:81304830-81304852 CCTGGCCTGTCTGCCCTCTGCCG 0: 1
1: 1
2: 6
3: 40
4: 438
Right 1152608581 17:81304882-81304904 CGGTGGTCCCATGGCCAGACGGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152608559 Original CRISPR CGGCAGAGGGCAGACAGGCC AGG (reversed) Intergenic
900095843 1:939828-939850 GGGCAGTGAGCAGAAAGGCCGGG + Intronic
900195386 1:1373194-1373216 CAGGAGATGGCAGACATGCCTGG + Intergenic
900241619 1:1620061-1620083 GGGCAGAGGGCAGAGATGTCGGG - Intronic
900243573 1:1627843-1627865 GGGCAGGGGGCACCCAGGCCAGG - Intronic
900243585 1:1627879-1627901 GGGCAGAGGGAACCCAGGCCAGG - Intronic
900243595 1:1627915-1627937 GGGCAGGGGGCACCCAGGCCAGG - Intronic
900538153 1:3189112-3189134 CGGCACTTGGAAGACAGGCCAGG - Intronic
900651286 1:3731192-3731214 CGGGCGGGGGCAGTCAGGCCAGG + Intronic
900717899 1:4156906-4156928 TGGCAGAGGAGAGAGAGGCCTGG - Intergenic
900991366 1:6099821-6099843 GGGCAGAGGGGAGAGAGGGCAGG + Exonic
901025960 1:6278903-6278925 CCGCAGAGGGAAGACAGAACTGG + Intronic
901181853 1:7347372-7347394 CGGCAGAGGCCCGACTGGCTGGG - Intronic
901533343 1:9867234-9867256 CAGCAGAGGCCAGGCAGGCTGGG + Intronic
901857565 1:12054140-12054162 CGGGCGAGGGCAGAGGGGCCGGG + Intergenic
902614619 1:17617053-17617075 GGGCTGAGGACACACAGGCCTGG + Intronic
904433632 1:30480263-30480285 CAGCAGGGGTCAGACAGGACAGG + Intergenic
904677407 1:32206858-32206880 CGGCAGAGGGAAGACGGGAAAGG - Intronic
904783852 1:32970875-32970897 AGGCAGAGAGAGGACAGGCCAGG - Intergenic
905123368 1:35699727-35699749 AGGCAGAGAGAAGTCAGGCCAGG - Intergenic
905373496 1:37501143-37501165 CGTCAGTGGACAGAGAGGCCAGG - Intronic
905868533 1:41390006-41390028 ATGCAGAGAGCACACAGGCCCGG + Intergenic
905878931 1:41451049-41451071 CGGCAGAGGGAGGGGAGGCCAGG - Intergenic
907273287 1:53303227-53303249 GGGCCGGGGGCAGACAGGCAAGG + Intronic
907316824 1:53577580-53577602 CACCTGAGGGCAGCCAGGCCTGG + Intronic
907498476 1:54861053-54861075 AGGCCAAGGGCAGAGAGGCCAGG - Intronic
907524524 1:55046500-55046522 CTGCAGAAGCCAGAGAGGCCGGG - Intronic
907525148 1:55049690-55049712 CAGCAGAGGGCAGGTGGGCCTGG - Intronic
908128868 1:61054731-61054753 CCGTCGAGGGCAGGCAGGCCTGG - Intronic
908200194 1:61787433-61787455 AGGAAGAGGACAGAAAGGCCAGG - Intronic
911052883 1:93686632-93686654 CAGCAGGGGTCAGACAGACCTGG - Intronic
912421967 1:109548690-109548712 CGGGAGAGGGGACACGGGCCCGG - Exonic
912694896 1:111833952-111833974 GGGCCCAGGGCACACAGGCCAGG + Intronic
912845824 1:113073707-113073729 AGGCAGGAGGGAGACAGGCCTGG + Intronic
913547200 1:119880851-119880873 CCGCAGAGGGCTGACTGGGCTGG + Intergenic
913557005 1:119977486-119977508 CCGCAGAGGGCTGACTGGGCTGG - Intronic
913939543 1:125087800-125087822 CGGCAGGGGGCAAACAGCCGCGG + Intergenic
915071281 1:153271001-153271023 CTGCAGAGGCCTTACAGGCCTGG - Intergenic
915368001 1:155326091-155326113 GGGCAGAGGCCAGACAGCCAAGG - Intronic
915443058 1:155958512-155958534 AGCCAGAGGGAAGAGAGGCCAGG - Intronic
916577513 1:166080886-166080908 GGTCAGAGGGGAGCCAGGCCAGG + Intronic
917303733 1:173605897-173605919 TGGTAGAGGACAGAAAGGCCTGG - Intergenic
917959245 1:180129132-180129154 TGGCAGAGGCCCGTCAGGCCTGG + Intergenic
917976893 1:180245452-180245474 CTGCATGGGGCAGACAGGCATGG + Intronic
920309625 1:205041419-205041441 CTGCAGGGGGCTGACGGGCCAGG - Intergenic
921163713 1:212491050-212491072 GGGCAGAGGCCAGACAGGTAAGG - Intergenic
922134826 1:222814871-222814893 GGGCAGAGGGCAGAGGGGCTTGG - Intergenic
922471542 1:225880180-225880202 TCGGAGAGGGCAGACAGGACTGG - Intronic
922871459 1:228905309-228905331 TGGAAGAGGGCAGCCAGGCACGG + Intergenic
924294863 1:242576523-242576545 AGCCAGAGGGCAGACAGGATGGG + Intergenic
924434846 1:244030313-244030335 CTGCAGAGGTAAGCCAGGCCAGG + Intergenic
924468112 1:244316069-244316091 CAGCAGAGCGCAGACAGGGCTGG - Intergenic
924625029 1:245690267-245690289 CGGGAGGGGAGAGACAGGCCAGG - Intronic
1062764234 10:48923-48945 CGGGAGGAGACAGACAGGCCGGG + Intronic
1063654154 10:7970458-7970480 AGGCCTCGGGCAGACAGGCCTGG - Intronic
1063662450 10:8043776-8043798 CCCCAGAGGGCAGACAGACCTGG + Intergenic
1063762677 10:9098141-9098163 CAGCAGAGGGCAGCTAGGCCAGG + Intergenic
1064307970 10:14185803-14185825 CGGAATAGGGTAGACAGGGCAGG + Intronic
1067848167 10:49739074-49739096 AGGCAGAAGGGAGACAGGCAGGG - Intronic
1069553817 10:69383604-69383626 CGGCAGAGGTCAGCCAATCCTGG - Intronic
1069852813 10:71421305-71421327 GGGCAGGGGGCCAACAGGCCAGG - Intronic
1069909475 10:71750724-71750746 GGCCAGTGGGCAGGCAGGCCTGG + Exonic
1070772812 10:79092183-79092205 CAGCAGCAGGCAGACAGGCTGGG - Intronic
1072619833 10:97072604-97072626 CGGCTGTGGGCTGACTGGCCAGG - Intronic
1075703456 10:124484113-124484135 CGGCAGGGGAGACACAGGCCCGG - Intronic
1076490604 10:130858877-130858899 CTGCAGAGGGCACAGAGTCCAGG + Intergenic
1076589087 10:131570866-131570888 CTGAAGAGGGAAGCCAGGCCAGG + Intergenic
1076593611 10:131609380-131609402 GAGCAGAGGGCAGAGAGCCCAGG + Intergenic
1076900405 10:133335093-133335115 CAGCGGAGGGCCGAGAGGCCGGG + Intronic
1077047585 11:553261-553283 CCTCAGCGGGCAGGCAGGCCGGG + Intronic
1077053846 11:580447-580469 AGGCAGAAGGCACAGAGGCCAGG - Intronic
1077650555 11:3967890-3967912 AGGCAGGGGGCAGCCAGCCCAGG - Intronic
1078670591 11:13361569-13361591 CTGGAGTGAGCAGACAGGCCAGG - Intronic
1078846385 11:15122592-15122614 CTGCACAAGGCAGACAGACCTGG + Intronic
1081597764 11:44471030-44471052 GGGCAGAGGGGAGGCAGGCGGGG - Intergenic
1081975955 11:47234968-47234990 CAGCAGTGGTCAGACAGGCAGGG - Intronic
1082929040 11:58579713-58579735 CGGCAGGGGGCAGACCAGGCAGG - Intronic
1083398995 11:62411131-62411153 TGGGAGAGGGCAGACAGGCACGG + Intronic
1083596456 11:63920232-63920254 AGGCAGAGCGCAGAGAAGCCCGG - Intergenic
1083726546 11:64631326-64631348 AGGCAGAGGACAGACAGGGACGG + Intronic
1083726878 11:64633096-64633118 CGGCAGAGGGCAGGGAAGACGGG - Intronic
1083735183 11:64676119-64676141 AGGCAGCGGGCAGAGAGGGCAGG + Intronic
1083824043 11:65188318-65188340 GGGCCGGGGGAAGACAGGCCAGG + Intronic
1084151636 11:67290258-67290280 GGGCAGTGAGCAGCCAGGCCTGG + Intronic
1084332932 11:68440237-68440259 TCACAGAGGGCAGACAGGCCTGG - Intronic
1085514368 11:77103793-77103815 CGGCAAAGGGCACCAAGGCCAGG - Intronic
1088506210 11:110530041-110530063 CACCAAAGGGCAGAGAGGCCTGG - Intergenic
1090363428 11:126188373-126188395 CGGCAGAGGTCAGAAAGCCCAGG - Intergenic
1090447417 11:126776057-126776079 CCCCAGAGGGAAGTCAGGCCTGG + Intronic
1090663120 11:128895685-128895707 GCTCAGAGGGCAGGCAGGCCCGG - Intronic
1091223547 11:133944862-133944884 GGGCAGAGGGAAGGCAGGCTGGG + Intronic
1091263697 11:134253871-134253893 CCGGAGGGGGCAGCCAGGCCGGG - Intronic
1092280489 12:7094168-7094190 GGGCAGAGTGGAGACAGGGCTGG - Intronic
1092404815 12:8212769-8212791 AAGCAGAGGGTAGACTGGCCAGG - Intergenic
1092884098 12:12910626-12910648 AGGCAGAGGACAGACACACCTGG - Intronic
1094395906 12:30005664-30005686 GGGGAGAGGGAAGCCAGGCCTGG - Intergenic
1094809655 12:34124815-34124837 AGGAAGAGGGCAGACAAGACCGG - Intergenic
1095089154 12:38087943-38087965 TGCCTGAGAGCAGACAGGCCAGG - Intergenic
1095102867 12:38201895-38201917 TGGGAGGGGCCAGACAGGCCAGG - Intergenic
1097173440 12:57129507-57129529 GGGCAGAGGGCAGGCAGGCCCGG + Intronic
1097185866 12:57196011-57196033 GGGCAGAGGGGAGCCAGGTCTGG - Intronic
1097187975 12:57205688-57205710 CACCAGAGGGCAGAAAGGCTGGG + Intronic
1097208262 12:57342888-57342910 GGGCAGAAGGCAGACAGCACAGG + Intronic
1098064722 12:66601709-66601731 CAGCAGAGAGGAGACAGGCAGGG + Intronic
1100883064 12:99039635-99039657 CGCCAGAGGGAAGGCAGGCTTGG - Intronic
1102016945 12:109654386-109654408 CCCCAGAGGGCAGCCAGGTCAGG - Intergenic
1102037184 12:109777843-109777865 CTGCAAAGGGCACACAGGTCAGG + Intergenic
1102060379 12:109926733-109926755 CAGCAGGAGGCAGACAGTCCTGG + Intronic
1102406916 12:112681266-112681288 CCACAAAGGGCAGTCAGGCCTGG - Intronic
1102495580 12:113316775-113316797 CGGCAGAGGGCAGACAACCCTGG + Intronic
1102812121 12:115833290-115833312 CGGCAGAGGGAACCCAGGCTGGG - Intergenic
1103476354 12:121221890-121221912 CTGCAGAGGGGAGACAGCACGGG - Intronic
1103972229 12:124679427-124679449 CTGCACAGGGGAGACAGGACAGG + Intergenic
1104016074 12:124963232-124963254 CGGCAGAGGCCAGACACGAGGGG + Intronic
1104095432 12:125552877-125552899 CGGCAGAGGGCCATCAGGCCTGG + Intronic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1104712263 12:130995239-130995261 CCGCAGAGGGCAGCCCTGCCTGG - Intronic
1104714350 12:131006534-131006556 AGGCAGGGGGCAGACAGAGCAGG - Intronic
1104748014 12:131221926-131221948 TGGCAGAGGGCAGAGGGGTCAGG + Intergenic
1104903543 12:132201805-132201827 CAGCAGAGGGAAGAGACGCCTGG - Intronic
1104915393 12:132261799-132261821 GGGCAGATGGGGGACAGGCCTGG + Intronic
1105790884 13:23797556-23797578 CGGCAGCCAGCAGACAGACCTGG - Intronic
1106644648 13:31619067-31619089 CTGCAGGGGACACACAGGCCTGG - Intergenic
1106911954 13:34472384-34472406 TGGCAGTGGGCAGCCAGGCAGGG + Intergenic
1109136385 13:58656600-58656622 AGGCAGAGGGCAGCCAGGCCAGG - Intergenic
1109173056 13:59119402-59119424 GGGCAGAGGGCAGAGAGCCAGGG + Intergenic
1112326118 13:98443823-98443845 AGACAGAGCGCAGACAGGACTGG + Intronic
1112498352 13:99923121-99923143 CAGCAGAGACCAGGCAGGCCGGG - Intergenic
1113454421 13:110438076-110438098 TGGCAGAGCGCCGACAGCCCAGG - Intronic
1113655063 13:112062901-112062923 CGGCAGAGAGCGGAGAGCCCCGG + Intergenic
1113850406 13:113414433-113414455 CCGCAGAGGGCAGGGAGGCTGGG - Intergenic
1114295391 14:21324754-21324776 CGGCAGATGTCAGGAAGGCCTGG - Exonic
1115320840 14:32077461-32077483 CGGGAGGGGGCAGGCAGGCTTGG - Intronic
1119478747 14:74946913-74946935 AGGCAGAGCCCAGACATGCCTGG - Intronic
1119722577 14:76901166-76901188 AGGCAGAGGGCAGAAAGGAGAGG + Intergenic
1119804751 14:77475447-77475469 TGGCAGAGGGCACACAGCCTCGG + Exonic
1119986298 14:79142131-79142153 TTGAAAAGGGCAGACAGGCCAGG + Intronic
1120335801 14:83152955-83152977 CAGCAGAAGGCAGACTGGCGGGG + Intergenic
1120786771 14:88545250-88545272 AGGCAGAGGGCACACATACCTGG + Intronic
1121640968 14:95484476-95484498 GGTCAGAGGGCAGGCAGGCAGGG + Intergenic
1122156766 14:99754676-99754698 CGGCACAGGGCAGAGAGCACTGG + Intronic
1122189250 14:100026957-100026979 ATGCAGAGGGCAGACAGACCAGG + Intronic
1122307094 14:100773154-100773176 GGGAAGCGGGCAGCCAGGCCCGG - Intergenic
1122365757 14:101194040-101194062 AGGCCTGGGGCAGACAGGCCGGG - Intergenic
1122414020 14:101540243-101540265 AGGGAGGGGGCAGGCAGGCCAGG - Intergenic
1122427346 14:101619730-101619752 GTAGAGAGGGCAGACAGGCCTGG + Intergenic
1122504959 14:102226562-102226584 GGGCTGAGGGCAGAGGGGCCAGG - Intronic
1122651234 14:103228314-103228336 AGGCAGAGGGCAGACACCGCTGG + Intergenic
1122743917 14:103887157-103887179 AGGCAGGGGGCAGCCAGGCTGGG - Intergenic
1122859564 14:104576463-104576485 CGGGAGAGGGCAGGCAGGGGTGG - Intronic
1122901833 14:104785251-104785273 GGGCAGAGGCCTGGCAGGCCGGG - Intronic
1122955307 14:105067653-105067675 CTGCAGGGTCCAGACAGGCCAGG - Intergenic
1122981632 14:105194800-105194822 AGCCAGAGGGCACACAGCCCAGG - Intergenic
1123018767 14:105387801-105387823 CGGCAGAGGGCAGGTGGCCCTGG + Intronic
1123039316 14:105483908-105483930 CGGCAGCCTGCAGCCAGGCCTGG - Intergenic
1123111119 14:105867237-105867259 CTGCTCAGGGCAGCCAGGCCAGG - Intergenic
1202864343 14_GL000225v1_random:105224-105246 CGCCAGAGGGGTGTCAGGCCTGG - Intergenic
1202867928 14_GL000225v1_random:135346-135368 CGCCAGAGGGGTGTCAGGCCTGG + Intergenic
1124516989 15:30375022-30375044 CTGCAGTGGGGACACAGGCCTGG + Intronic
1124522882 15:30420309-30420331 CAGCAGCGCGCAGCCAGGCCTGG + Intergenic
1124535783 15:30545908-30545930 CAGCAGCGCGCAGCCAGGCCTGG - Intergenic
1124620721 15:31272454-31272476 TGGCAGAGGCCAGGCAGGTCTGG + Intergenic
1124725927 15:32155695-32155717 CTGCAGTGGGGACACAGGCCTGG - Intronic
1124762867 15:32461692-32461714 CAGCAGCGCGCAGCCAGGCCTGG + Intergenic
1124775759 15:32587366-32587388 CAGCAGCGCGCAGCCAGGCCTGG - Intergenic
1126458505 15:48890518-48890540 CTGCAGAGGGGAGAAAGCCCTGG - Intronic
1127257969 15:57307287-57307309 GGGCAGAAGGCACACAGGTCTGG - Intergenic
1128080914 15:64856429-64856451 AGGCAGAGGCCAGAGAGGCTAGG - Intronic
1128237233 15:66076706-66076728 AGGCAGAGGGAGGTCAGGCCAGG + Intronic
1128290755 15:66476692-66476714 AGGCAGAGGGCAGCCATGGCAGG + Intronic
1128365078 15:66993940-66993962 GGGGAGATGGCAGGCAGGCCAGG + Intergenic
1128501055 15:68228017-68228039 CGGCGTGGGGCAGACAGCCCGGG + Intronic
1129414511 15:75367981-75368003 CGGCAGAGGGCAGACAACGAAGG + Intronic
1129483380 15:75844426-75844448 CAGCAGCGCGCAGCCAGGCCCGG - Intronic
1129879756 15:78998839-78998861 TGGCAGAGGGGAGAGAGGACAGG + Intronic
1129911377 15:79229929-79229951 TGGCAGAAGGCAGAAAGGCAAGG - Intergenic
1131177674 15:90220140-90220162 CAGAAGAGGGCAGCAAGGCCTGG - Intronic
1132113253 15:99117472-99117494 GGGCAGATGCCAGGCAGGCCTGG + Intronic
1132379397 15:101356023-101356045 CGTCAGACATCAGACAGGCCTGG - Intronic
1132459340 16:42844-42866 AGGAAGAGGGCAGACAAGACAGG + Intergenic
1132648473 16:1009904-1009926 AGGGAGAGGGGAGACAGGTCTGG + Intergenic
1132731835 16:1366639-1366661 CGGCAGTGGCCAGACAGGCCAGG + Intronic
1132883157 16:2171159-2171181 CCTCAGAGGACAGCCAGGCCTGG + Intronic
1132883295 16:2171699-2171721 CAGCAGAGGCCAAACAGGGCCGG - Intronic
1133301118 16:4783590-4783612 GGGCAGAGGGCAGAGTGGGCAGG - Intronic
1135572953 16:23563333-23563355 AGGCAGAGGGCAACCAGGCGGGG - Intronic
1135972270 16:27081147-27081169 CAGCACAGAGCAGACAGGCAAGG + Intergenic
1136118066 16:28108357-28108379 AGGCAGAGGTCAGAGAGCCCTGG + Intronic
1136278410 16:29192742-29192764 AGTCAGAGTGCAGACAGGACTGG + Intergenic
1136656316 16:31711396-31711418 GGCCTGAGGGCAGACAGGCCAGG - Intergenic
1137441994 16:48505815-48505837 CGGGAGAGGGCAGAAGGGCAGGG + Intergenic
1137591443 16:49696546-49696568 GGGGAGAGGCCAGCCAGGCCTGG - Intronic
1137780558 16:51094709-51094731 CAGCAGAACGCAGGCAGGCCTGG - Intergenic
1137785934 16:51137770-51137792 TGGAAGAGGGGAGACAGCCCAGG - Intronic
1138032666 16:53572676-53572698 AGGCAGAGGTCAGAGAGACCTGG - Intergenic
1138282016 16:55779488-55779510 CAGCATGGGGAAGACAGGCCGGG - Intergenic
1138337863 16:56267189-56267211 CAGCAGAGGGCAGGCACCCCAGG - Intronic
1138351552 16:56348712-56348734 CGAGGGAGGGCAGTCAGGCCTGG + Intronic
1139383297 16:66548266-66548288 CTGCAGAGGGTAGACAGTGCGGG - Intronic
1139590731 16:67931457-67931479 CGGGAGGGGGCAGAGAGACCAGG - Intronic
1141063655 16:80897342-80897364 CGGCAAAGGGCCGAGAGGGCTGG + Intergenic
1141074085 16:80986660-80986682 CGGCAGAGAACACACAGCCCTGG + Intronic
1141675331 16:85514476-85514498 AGGGACAGGGCAGTCAGGCCTGG + Intergenic
1142082793 16:88158775-88158797 AGTCAGAGTGCAGACAGGACTGG + Intergenic
1142440415 16:90094310-90094332 CGGGAGGGGCCAGACAGGCCGGG - Intergenic
1143586104 17:7851301-7851323 AGCCAGAGGGTAGGCAGGCCTGG - Intronic
1143736780 17:8916617-8916639 CTGCATGGGGCAGAAAGGCCTGG + Intronic
1144484606 17:15654317-15654339 TGGAAGAGGGCAGTCAGGACAGG - Intronic
1145271167 17:21405648-21405670 CGACTGAGGGCCAACAGGCCGGG - Intronic
1145309371 17:21693035-21693057 CGACTGAGGGCCAACAGGCCGGG - Intronic
1145973975 17:28973702-28973724 TGACAGAGGCCAGACAGGGCTGG + Intronic
1145993160 17:29091257-29091279 GGGCAGAGTGCACGCAGGCCAGG - Intronic
1146790007 17:35745769-35745791 TGGCAGAGGCCAGAGAGTCCTGG - Exonic
1146914976 17:36672683-36672705 CAGCAGAGGCCAGAGAGGCAGGG - Intergenic
1147475476 17:40707803-40707825 GGGAAGAGGGCAGAAAGGTCAGG + Intergenic
1148175799 17:45563521-45563543 CTGCAGAGGGCAGAGATGCAGGG + Intergenic
1148432222 17:47650834-47650856 CGGCCGGGGTCAGACAGGGCGGG - Intronic
1148690984 17:49526800-49526822 GACCAGAGGGCAGACAGGCTTGG - Intergenic
1148779311 17:50112609-50112631 GGGGAGAGGGCAGAGAGGCCAGG - Intronic
1149996275 17:61407605-61407627 GGGCAGAGGGCACACATGCTGGG - Intronic
1150471155 17:65438662-65438684 GGGCAGTGGGCAGTGAGGCCAGG - Intergenic
1151494266 17:74450072-74450094 GGGCAGAGTGCAGGCAGGGCTGG - Intronic
1151690375 17:75680440-75680462 AGCCAGAGGGAAGCCAGGCCAGG - Intronic
1151963365 17:77419057-77419079 CGGCAGAGAAGAGACAGGGCAGG - Intronic
1152309669 17:79542272-79542294 CTGCAGAGGGCAGCCAGGGAGGG - Intergenic
1152344538 17:79743117-79743139 GGGCAGGGGGCCCACAGGCCAGG - Intergenic
1152449437 17:80367686-80367708 GGGCTGAGGGCGGCCAGGCCGGG - Intronic
1152573141 17:81129177-81129199 GCCCAGAGGGCTGACAGGCCTGG + Intronic
1152608549 17:81304798-81304820 GGGCAGAGGGCAGACAGGCCAGG - Intergenic
1152608559 17:81304830-81304852 CGGCAGAGGGCAGACAGGCCAGG - Intergenic
1152740980 17:82018228-82018250 AGTCAGAGGGCAGCCAGACCTGG + Intergenic
1152813954 17:82396767-82396789 GGGGTGAGGGCAGACAGGCTGGG + Intronic
1152957147 18:49248-49270 CGGGAGGGGCCAGACAGGCCGGG + Intronic
1153386478 18:4503398-4503420 CAGCAGAAAGCATACAGGCCAGG + Intergenic
1154175802 18:12086847-12086869 CGGCAGAGGGCAGAACAGGCAGG - Intergenic
1154356818 18:13627843-13627865 GGCCAGAGGGCAGACGGTCCTGG + Intronic
1156494199 18:37515368-37515390 TGGCAGAGGGTAGCCAGGCTGGG - Intronic
1156502842 18:37570554-37570576 CTGCAGAGGGCAGTGAGGGCAGG + Intergenic
1157593683 18:48851135-48851157 GGGCAGAGGACAGACTGCCCAGG - Intronic
1158341456 18:56471197-56471219 AGGCGGAGAGCAGCCAGGCCAGG + Intergenic
1158968525 18:62644511-62644533 TGGCAGAGGGCAGAGAAGCAGGG + Intergenic
1160004576 18:75060356-75060378 CCGCAGGGGGGAGCCAGGCCTGG - Intronic
1160462114 18:79047175-79047197 CGGCAGAGGCCCGTGAGGCCCGG - Intergenic
1160518494 18:79491094-79491116 CGGGAGAGGGAAGGCAGGCTAGG + Intronic
1160587905 18:79922872-79922894 CATCAGAGGGCAGAGAGGCCAGG + Intronic
1160831727 19:1107533-1107555 AGGCAGTGGGCAGAAAGGCCTGG + Intergenic
1161143660 19:2664344-2664366 AGGAAGGGGGCAGAGAGGCCTGG + Intronic
1161210207 19:3062021-3062043 CTGGAGAGGGAAGACAGGGCCGG + Intronic
1161261891 19:3342370-3342392 AGGCAGAGGACAGAGAGCCCAGG + Intergenic
1161332180 19:3693578-3693600 CGGCAGGCGGCAGGGAGGCCTGG + Intronic
1162399096 19:10433863-10433885 GCGCACAGGGCAGGCAGGCCTGG - Intronic
1162736320 19:12748892-12748914 AGGCTGTGGGCACACAGGCCTGG + Intergenic
1162943425 19:14028056-14028078 CAGCAGAGGGGAGACAGGCACGG - Intergenic
1163654626 19:18538530-18538552 GGGCAGAGGGGAGACAGATCGGG - Intronic
1163766444 19:19165915-19165937 TGGCAGAGGGCAGAGAGGAAAGG + Intronic
1164011145 19:21204293-21204315 AGGAAGAGGGCAGACATGACTGG - Intergenic
1164580741 19:29433446-29433468 AGGCAGAGGGCCGTCAGCCCGGG - Intergenic
1165037877 19:33047629-33047651 GGGCAGAGGTCGGAGAGGCCAGG - Intronic
1165101105 19:33439272-33439294 AGGCAGGGGGCAGGAAGGCCAGG - Intronic
1166167888 19:41005150-41005172 TGGCAGTGAGCAGACAGGCCAGG + Intronic
1166272759 19:41727013-41727035 TAGCTGAGTGCAGACAGGCCAGG + Intronic
1166685340 19:44793241-44793263 CAGGAGGGGGCACACAGGCCAGG - Intronic
1167272945 19:48516691-48516713 CCACAGAGGGCACAAAGGCCTGG + Intergenic
1167783134 19:51613515-51613537 CGGCACAGGGCAGACAGGGCTGG + Intronic
1168056936 19:53869326-53869348 CGGGAGAGGGCGGGCAGCCCCGG + Intronic
1168467107 19:56611861-56611883 CAGCAGGTGGGAGACAGGCCTGG - Intronic
925254870 2:2474870-2474892 TGGGAGGTGGCAGACAGGCCTGG - Intergenic
926289489 2:11517188-11517210 AGGCAAAGGGCAGGGAGGCCGGG - Intergenic
926710058 2:15872078-15872100 CGGAAGAGGGGATGCAGGCCAGG + Intergenic
927449784 2:23198930-23198952 GGGCAGAGGGAAGAGAGGCACGG + Intergenic
928411484 2:31057830-31057852 AGCCAGAGGGCTGAGAGGCCAGG - Intronic
929188700 2:39120719-39120741 CGGCAGAGGGCAGCCCGGGGCGG - Intronic
929239607 2:39640214-39640236 CAGCAAAGGGCAGATAGGCATGG - Intergenic
929547312 2:42863981-42864003 AGTCAGAGGGCAGCGAGGCCGGG - Intergenic
929978365 2:46656377-46656399 CGGCAGAGGGTAGGCAGGGGTGG - Intergenic
932774277 2:74517915-74517937 TGACAGAGGGAAGAGAGGCCAGG + Intergenic
933510660 2:83237473-83237495 CTGAAGAGGGCAGAAAGGACAGG - Intergenic
933668003 2:84980298-84980320 TGGCAGAGGAAAGACAGGCAAGG + Intronic
934467109 2:94273100-94273122 CCGCAGCGGGCAGAAAGGCGCGG + Intergenic
934901773 2:98165539-98165561 GGGCAGAGGGCAGGGAGGTCAGG + Intronic
935728778 2:106047404-106047426 CAGCAGAAGACAGCCAGGCCAGG + Intergenic
936088986 2:109488862-109488884 AGGCAGAGGGGAGATAGGCCGGG + Intronic
937019043 2:118633619-118633641 CGGCACTGGGGATACAGGCCGGG - Intergenic
937368921 2:121284722-121284744 CCGCAGGGGGCGGACGGGCCAGG + Intronic
937661784 2:124438307-124438329 CGGCAGAGGGCAGACTGCCATGG - Intronic
945119359 2:206442859-206442881 CGGCAGGGAGGACACAGGCCGGG + Intergenic
946395532 2:219442110-219442132 CGGGAGGGGGCAGGGAGGCCTGG + Intronic
946396204 2:219444910-219444932 GGGCAGCGGGCAGACGGTCCTGG + Exonic
948150966 2:235744383-235744405 GGGCAGCGGGCGGACAGGCCAGG + Intronic
948466751 2:238155905-238155927 GGACAGAGAGCAGAGAGGCCGGG - Intergenic
948708133 2:239807777-239807799 GGGCAGGGGGCAGGCAGGTCTGG + Intergenic
948845372 2:240680473-240680495 GGGCAGAGCACAGACAGCCCTGG + Intronic
948848489 2:240694406-240694428 GGGCAGAGCACAGACAGCCCTGG - Intronic
948915280 2:241031472-241031494 AGGCACTGGGCAGACAGCCCTGG + Intronic
948982545 2:241501726-241501748 GGACAGAGGGCAGACAGCGCCGG + Intronic
1171006074 20:21467046-21467068 CCACAGAGGGCACCCAGGCCTGG - Intergenic
1171778652 20:29396406-29396428 AGGCAGAGGGCAGCAAGACCAGG - Intergenic
1172949757 20:38715350-38715372 CTGCAGAGGGCAGGAAGCCCAGG + Intergenic
1174085903 20:48006932-48006954 CGCCAGAGGGCAGGGAGCCCCGG + Intergenic
1174494724 20:50931293-50931315 CGGCGGAGGGGAGACCGGGCCGG + Intergenic
1174792222 20:53489838-53489860 TGGCTGAGTGAAGACAGGCCTGG - Exonic
1175323682 20:58107686-58107708 CAGCAGGGGCCAGGCAGGCCAGG - Intergenic
1175371666 20:58496648-58496670 CAGCATGGGGCAGACAGGCCGGG + Intronic
1175406874 20:58740719-58740741 CTGAAGAGGGCAGGCAGGTCAGG + Intergenic
1175516694 20:59574702-59574724 GGGCAGAGGACAGGCTGGCCAGG - Intergenic
1175700849 20:61136012-61136034 CGGGTGAGGGGAGTCAGGCCGGG + Intergenic
1176141710 20:63547771-63547793 CGGCAGAGGGCAGCTTGGGCTGG + Intergenic
1176586659 21:8594897-8594919 CGGCAGAGGGCAAAAAGCCGCGG - Intergenic
1176678053 21:9799638-9799660 GGGCAGAGGGCACAGAGTCCAGG - Intergenic
1178597696 21:33969620-33969642 CGGCAGAGAACACCCAGGCCAGG - Intergenic
1178605550 21:34033690-34033712 CGCCAGAAGACAGAAAGGCCAGG + Intergenic
1179131341 21:38639906-38639928 TGCCAGAGGGCAGAGATGCCAGG + Intronic
1179542878 21:42095013-42095035 CACCAGAGGGCAGAGAGGCAAGG - Intronic
1179822239 21:43943652-43943674 CGGCTGAGGCCTGGCAGGCCAGG - Intronic
1180086936 21:45511940-45511962 CGGCAGAGGGGAGAGGGGCCAGG - Intronic
1180201657 21:46228460-46228482 CGGCCGCGAGCAGACCGGCCTGG - Exonic
1180963567 22:19773853-19773875 CGGCTGAGGGCCGAGGGGCCAGG - Intronic
1180985729 22:19903084-19903106 CCTCAGAGGGTGGACAGGCCTGG + Intronic
1180990120 22:19930642-19930664 GGGCAGAGAGCAGGCAGGCAGGG + Intronic
1181521320 22:23450204-23450226 CCTCAGAGCGCGGACAGGCCAGG + Intergenic
1181901808 22:26162178-26162200 AGCCAGAGGTCAGACAGCCCTGG + Intergenic
1181914481 22:26268601-26268623 GAGCAGAGGGCACATAGGCCAGG + Intronic
1182365812 22:29778180-29778202 AGGAAGTGGGCAGACAGGGCAGG + Intergenic
1182377006 22:29856046-29856068 TGGCAGAGGGCACAGAGCCCAGG - Intergenic
1182647526 22:31822425-31822447 AGGCATAGGGCAGACAGGGCGGG + Intronic
1183439663 22:37816046-37816068 AGGCAGAGGGGAGCCAGGCAGGG - Intronic
1184895052 22:47401764-47401786 GGGCAGGGGACAGACGGGCCAGG + Intergenic
1184924191 22:47625917-47625939 GGGCAGAGGGCAGGGTGGCCAGG - Intergenic
1184981882 22:48100921-48100943 CTGGAGAGGGCAGCGAGGCCAGG - Intergenic
1185246884 22:49777358-49777380 CTTCACAGGGCAGACAGGCAGGG + Intronic
949533627 3:4979250-4979272 CGGCAGTGGCCAGACGTGCCTGG + Exonic
949993764 3:9600786-9600808 CGGCGAAGGGCAGGCAGGTCGGG - Intergenic
950108250 3:10402026-10402048 CGGCAGAGGTGGGACAGGCCAGG - Intronic
950303501 3:11901256-11901278 CTGCAGAGGACAAACAGGCAGGG - Intergenic
950889093 3:16387317-16387339 CAGCAGAGGGGAGAAAGCCCTGG - Intronic
952000704 3:28782488-28782510 CGGCAGAGGGGAGACTGGGATGG + Intergenic
953186355 3:40641808-40641830 CGGCAGTTGGAAGTCAGGCCTGG + Intergenic
953903182 3:46854735-46854757 TGGCAGAGGGCACAGAGGCCTGG - Intergenic
954331945 3:49895904-49895926 GGGCAGAGGGCCTACAGGCTGGG - Intronic
954629885 3:52042055-52042077 AGGGAAAGAGCAGACAGGCCAGG + Intergenic
955389733 3:58512579-58512601 CGGCAGAGGGCAGAGAGTTAAGG - Intronic
955880534 3:63539854-63539876 GGACAGAGGGCAGAGAGGCTGGG + Intronic
956574516 3:70737157-70737179 CTGCAGGGGAGAGACAGGCCAGG + Intergenic
956891911 3:73622252-73622274 CTGCAGCTGACAGACAGGCCAGG + Intronic
957086494 3:75684154-75684176 AGGCAGAGGGCAGCAAGGCCAGG + Intergenic
959709344 3:109369678-109369700 CAGCAGAGGGCAGACAGGGCAGG - Intergenic
961168011 3:124776948-124776970 CTGCAGAGGGGAGCCAGGCAAGG + Intronic
961594452 3:128006002-128006024 TGCCAGAGGGCAGAAAGCCCAGG - Intergenic
962161615 3:133006532-133006554 TATCAGAGGGCAGACAGGCAAGG + Intergenic
962652380 3:137509603-137509625 CGGCAGAGAGCACACAGACCTGG + Intergenic
966887158 3:184383097-184383119 CTGGAGTGGGCAGGCAGGCCAGG + Exonic
966945280 3:184773441-184773463 GGGCCGAGGGCAGGCGGGCCGGG - Intergenic
967100288 3:186210448-186210470 GGTAAGAGGGCAGAGAGGCCAGG - Intronic
968129365 3:196183790-196183812 CTGCAGAGGCCTGACAGGCTGGG - Intergenic
968458888 4:713825-713847 CAGCAGAGGGCGCACAGGGCAGG + Intronic
968501772 4:953444-953466 GGGCAGAGCGCAGACAGGCAGGG + Intronic
968584828 4:1411445-1411467 AGGCAGAGGCCAGAGAGGGCAGG - Intergenic
968905831 4:3450080-3450102 GGCCAGAGGGCAGAGAGGGCGGG + Intergenic
969455548 4:7297867-7297889 AGCCAGAGGACAGACAGGGCTGG - Intronic
969535790 4:7755435-7755457 TGGCAGAGGGCAGAGAGAGCAGG - Intergenic
969588006 4:8105664-8105686 CCGCAGAAGGCAGGCAGGCACGG + Intronic
969605218 4:8199092-8199114 GGGCAGCGGGCAGGCAGGACAGG + Intronic
969662181 4:8536746-8536768 GGGCAGGGGCCAGACAGGCTCGG + Intergenic
971219117 4:24688809-24688831 TGGCAGAGGGGAGAAAGGCAAGG - Intergenic
972726841 4:41752004-41752026 GGGCAGAGGGACGATAGGCCAGG - Intergenic
973537812 4:51901500-51901522 AGGCAGAATGCAGAGAGGCCAGG - Intronic
973703404 4:53558309-53558331 CGGCTGGGAGCAGACAGGCTGGG + Intronic
976612565 4:87045108-87045130 CAGAAGAGGGCAAAGAGGCCAGG + Intronic
977836145 4:101648020-101648042 TGGGGCAGGGCAGACAGGCCAGG - Intronic
982326864 4:154137243-154137265 AGGCTGAGGGCACTCAGGCCAGG + Intergenic
982461019 4:155668136-155668158 CGACAGGGTGCAGACAGGCGCGG - Intronic
983491872 4:168398490-168398512 CAGCAGGAGGCAGACAGGCTCGG + Intronic
983844150 4:172495479-172495501 CAGCAGAGGGGAGAGAGGACAGG - Intronic
985441417 4:189984562-189984584 CGGGAGGGGCCAGACAGGCCGGG + Intergenic
985541479 5:489460-489482 CAGCAGAGAGCAGCCTGGCCAGG + Intronic
986600107 5:9464654-9464676 CGGCAGATGGCATCCAAGCCTGG - Intronic
987294997 5:16541990-16542012 AGGCTGAGGGCAGAAAGGCATGG + Intronic
991320735 5:65370673-65370695 CGGCAAAGGGCAGCGAGGCTGGG + Intronic
997294626 5:132761878-132761900 CGGCAAAGGGCAGATGTGCCTGG + Exonic
997632284 5:135377987-135378009 CGGCAGACAGCACAGAGGCCAGG - Intronic
998354174 5:141520806-141520828 AGGCTGAGGGGAAACAGGCCTGG + Intronic
999232779 5:150071647-150071669 CAGCACAAGGCAGACAAGCCTGG - Intronic
1001419149 5:171573797-171573819 CGGTATAGGGCAGCCAGGCCTGG - Intergenic
1001453683 5:171845243-171845265 AGGCAGTGGGGAGCCAGGCCAGG - Intergenic
1002040481 5:176510269-176510291 AGAGAGAGAGCAGACAGGCCTGG + Intergenic
1002160733 5:177312572-177312594 GGGCAGATGGCAGGCAGGCTTGG - Intronic
1002269174 5:178058476-178058498 CGGCAGCGGGCTGAGAGCCCTGG - Intergenic
1002866783 6:1128964-1128986 CAGCGGAGGGAAGACAGGACTGG + Intergenic
1003369189 6:5508458-5508480 GGGCAGAATGCAGAGAGGCCAGG + Intronic
1003395261 6:5747518-5747540 CAGCATATGGCAGACAGGACAGG - Intronic
1003398879 6:5775475-5775497 TGGAAGAGCGCAGACAGCCCAGG - Intergenic
1005608962 6:27504910-27504932 CGGAAGAGAGGAGAAAGGCCAGG - Intergenic
1005897460 6:30190358-30190380 CGGCAGAGGCCAGACTGCGCAGG + Intronic
1007177201 6:39905103-39905125 GGGCAGAGGGGAGGCAGGCAGGG + Exonic
1007409541 6:41653881-41653903 CCGCAGGGGGCAGCCAGGGCTGG + Exonic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007750347 6:44067348-44067370 GGGGAGTGGGCAGACAAGCCTGG + Intergenic
1007776797 6:44228518-44228540 AGGCAGTGAGAAGACAGGCCTGG - Intronic
1012401421 6:98845260-98845282 CGGCGAGGGGCGGACAGGCCGGG - Intergenic
1013358734 6:109373392-109373414 CGGCAGACGGTACACATGCCCGG + Intronic
1013811527 6:114049867-114049889 CAGCAGAGGGAAGACAAGCTGGG + Intergenic
1015898080 6:138036211-138036233 GGACAGAGGGCACAGAGGCCTGG + Intergenic
1016370818 6:143372100-143372122 CGGGAGAGGGCAGAATGCCCAGG - Intergenic
1017970018 6:159304096-159304118 CAGCAGACGGCAGTCAGGACAGG - Intergenic
1018732083 6:166658908-166658930 GGGCAAAGGGCAGACATGCTGGG + Intronic
1018896163 6:168018969-168018991 CTGCAGAGCTCACACAGGCCTGG + Intronic
1019184494 6:170213213-170213235 AGGCAGAAGACAGACGGGCCCGG + Intergenic
1019474811 7:1238909-1238931 CCGCAGAGGCCAGACGGGACCGG - Intergenic
1019538761 7:1542019-1542041 GGGCAGAGGACAGACAGCCCCGG + Exonic
1019830335 7:3321951-3321973 AGGGAGAGGGCAAACAGGCTGGG - Intronic
1020124533 7:5526118-5526140 TAGCAGAGGGAAGGCAGGCCAGG + Intergenic
1021313060 7:19116611-19116633 TGGCAGACGGCAGGCCGGCCAGG - Intronic
1023966784 7:44967001-44967023 GGGCAGAGGCCAGCAAGGCCAGG + Intronic
1024224830 7:47318517-47318539 CAGCACAGGGCAGTCAGGCCAGG + Intronic
1024322973 7:48088507-48088529 CGGCCGGGGGCAGGCAGGTCCGG + Intergenic
1025099458 7:56123085-56123107 CGTCAGGGGGCAGAGAGGCACGG + Intergenic
1026224194 7:68426398-68426420 TAGCAGAGGTCTGACAGGCCAGG - Intergenic
1026896504 7:74012945-74012967 GGGCAGGGGGCAGGCAGGTCGGG - Intergenic
1027268110 7:76505016-76505038 AGGGAGAGGGCAGGGAGGCCTGG + Intronic
1028223188 7:88220064-88220086 GGGCAGGGGGCGGAGAGGCCTGG - Exonic
1029606486 7:101602223-101602245 CGGCAGAGCTGGGACAGGCCAGG + Intergenic
1030265999 7:107622528-107622550 GGTAAGAAGGCAGACAGGCCTGG - Exonic
1032499259 7:132387837-132387859 CGGCTGAGGGCATAGAGACCTGG - Intronic
1032643801 7:133798674-133798696 GGTCTGAGGTCAGACAGGCCTGG - Intronic
1034959364 7:155355411-155355433 CCCCAGAGGGCAGAAAGGCTGGG + Intergenic
1035470601 7:159106617-159106639 CGGGAAGGGGCAGAAAGGCCAGG + Intronic
1036796064 8:11757611-11757633 CTGCAGAGGGCAGGCAGGGCAGG + Intronic
1036845210 8:12163795-12163817 AAGCAGAGGGTAGACTGGCCAGG - Intergenic
1036866579 8:12406118-12406140 AAGCAGAGGGTAGACTGGCCAGG - Intergenic
1039428347 8:37505511-37505533 AGGCTGGGGGCAGAAAGGCCAGG + Intergenic
1039964190 8:42271757-42271779 GGGCAGAAGGCGGGCAGGCCCGG + Intronic
1042380111 8:68103929-68103951 TTGCAGAGGTCAAACAGGCCAGG - Intronic
1047725844 8:127683278-127683300 AGGCAGATGGCAGAAAGGCTGGG + Intergenic
1049053389 8:140216604-140216626 GGGCTGAGAGGAGACAGGCCAGG - Intronic
1049258577 8:141626792-141626814 GGGCAGAGGGCAGAGAGGGCAGG - Intergenic
1049561874 8:143316172-143316194 CGGCTCAGGGCAGACAGGGAGGG - Intronic
1049584307 8:143425845-143425867 GGGCAGGGGGCACCCAGGCCAGG + Intronic
1049621328 8:143599583-143599605 TGGCAGAGGGCAGACTGGCTGGG - Exonic
1049757822 8:144318609-144318631 TGGGAGAGGGCTGCCAGGCCTGG + Intronic
1049812029 8:144579920-144579942 TGGCCCAGGGCAGACAGGCCTGG - Intronic
1050426525 9:5517310-5517332 CGGAAGAGGCCACACAGGCCTGG + Intronic
1052072583 9:24100399-24100421 AGTCAGAGGGCAGACAGGTGTGG - Intergenic
1052995335 9:34549096-34549118 GGGCAGGGGGCTGATAGGCCAGG + Intergenic
1053434901 9:38068276-38068298 CGGCAGCGGGGAGCCAGGCGGGG - Exonic
1053456476 9:38236805-38236827 GGGCAGAGGCCAAACAGGTCTGG + Intergenic
1053943602 9:43280214-43280236 CCGCAGCGGGCAGAAAGGCATGG + Intergenic
1056808532 9:89746476-89746498 CAGCAGAGAGCTGACAGGCAGGG + Intergenic
1057260053 9:93577924-93577946 CCCCAGAGGGCATACAGCCCTGG - Intronic
1057291688 9:93810862-93810884 GGGCCGAGGGGAGACAGGTCTGG + Intergenic
1057869597 9:98708283-98708305 CTGCCGAGGGCAGAGAGGGCTGG - Intronic
1057949833 9:99360919-99360941 CTGTAGTGGGCAGAGAGGCCAGG + Intergenic
1060205964 9:121683045-121683067 TGGCACAGAGCAGACAGACCTGG - Intronic
1060596292 9:124851092-124851114 AGGCAGGGGCCAGACAGGCGGGG + Intergenic
1061168911 9:128940724-128940746 ATGCAGAGGGCAGAGAGGCAGGG + Intronic
1061240089 9:129365019-129365041 CAGCAGAGGGAAGAAGGGCCGGG + Intergenic
1061416991 9:130452378-130452400 TGGCAGGGGGCAGACAGGACAGG - Intronic
1061710889 9:132486978-132487000 CGGCAGAGCGCAGGCAGCCCCGG + Intronic
1061927634 9:133813755-133813777 TGGCAGAGGGCAGATGGCCCTGG + Intronic
1061968769 9:134031990-134032012 CTGGGGAGGGCAGACAGGCTCGG + Exonic
1062033181 9:134371275-134371297 CGGCAAAGGACACAGAGGCCTGG - Intronic
1062057041 9:134474155-134474177 GGGCAGAGAGCAGAAAGGGCCGG + Intergenic
1062090563 9:134676375-134676397 CTGCAGAGGCCAGACAGGAAGGG - Intronic
1062279334 9:135744952-135744974 TGGCAGAGGTGAGACGGGCCCGG + Intronic
1062538776 9:137032345-137032367 AGGCAGAGGACAGAGAGGCTCGG + Exonic
1062577301 9:137214711-137214733 CGGGAGAGGGCAGAGAGTCAGGG - Intronic
1062741003 9:138175330-138175352 CGGGAGGGGCCAGACAGGCCGGG - Intergenic
1203739981 Un_GL000216v2:170793-170815 CGCCAGAGGGGTGTCAGGCCTGG + Intergenic
1203586720 Un_KI270747v1:10117-10139 CCGCAGCGGGCAGAAAGGCATGG + Intergenic
1203663201 Un_KI270754v1:2130-2152 GGGCAGAGGGCACAGAGTCCAGG - Intergenic
1185477051 X:421666-421688 CTGCAGACAGCACACAGGCCAGG + Intergenic
1186388733 X:9136793-9136815 GGGCAGAGGGCAGACTGGGTGGG + Intronic
1186456801 X:9715988-9716010 CAGCACAGAGCAGAAAGGCCAGG - Intronic
1187000638 X:15173250-15173272 TGGGAAAGGGCAGACTGGCCTGG - Intergenic
1187553501 X:20329034-20329056 CACCAGAGGGCACAGAGGCCTGG - Intergenic
1189316753 X:40062146-40062168 CTGCAGCGGGCAGCCAGGCTTGG - Exonic
1191001397 X:55663256-55663278 GGGGAGGGGGCAAACAGGCCAGG + Intergenic
1192213630 X:69143065-69143087 GGGCGGGGAGCAGACAGGCCAGG + Intergenic
1193250675 X:79288175-79288197 CTGCAGAGGGCAGTCATGCATGG + Intergenic
1194923051 X:99791687-99791709 CGGCAGAGGCCTTACAAGCCAGG - Intergenic
1199967570 X:152832571-152832593 GGGCAGAGGGATCACAGGCCAGG - Intronic
1200010188 X:153114666-153114688 CTGCAGAGGTCAGAAGGGCCTGG - Intergenic
1200029412 X:153285256-153285278 CTGCAGAGGTCAGAAGGGCCTGG + Intergenic
1200064012 X:153496226-153496248 GGGCAGAGAGCTGGCAGGCCAGG - Intronic
1200114652 X:153764840-153764862 AGGCAGAGGGTCCACAGGCCGGG - Intronic
1200215402 X:154365995-154366017 CAGCAGAGGGCAGTCAGGGCCGG + Intronic
1201755604 Y:17482810-17482832 AGGAAGAGGGCAGACAAGACCGG - Intergenic
1201845948 Y:18423175-18423197 AGGAAGAGGGCAGACAAGACCGG + Intergenic