ID: 1152609850

View in Genome Browser
Species Human (GRCh38)
Location 17:81310149-81310171
Sequence TTGGGGGGGTGCGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152609850_1152609868 29 Left 1152609850 17:81310149-81310171 CCAGCAGCTGCGCACCCCCCCAA No data
Right 1152609868 17:81310201-81310223 CTGCCCACAACCGGCAGGACAGG No data
1152609850_1152609867 24 Left 1152609850 17:81310149-81310171 CCAGCAGCTGCGCACCCCCCCAA No data
Right 1152609867 17:81310196-81310218 GGAAGCTGCCCACAACCGGCAGG No data
1152609850_1152609864 20 Left 1152609850 17:81310149-81310171 CCAGCAGCTGCGCACCCCCCCAA No data
Right 1152609864 17:81310192-81310214 ACCCGGAAGCTGCCCACAACCGG No data
1152609850_1152609859 3 Left 1152609850 17:81310149-81310171 CCAGCAGCTGCGCACCCCCCCAA No data
Right 1152609859 17:81310175-81310197 CACGCCGGGCTCCCCGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152609850 Original CRISPR TTGGGGGGGTGCGCAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr