ID: 1152612415

View in Genome Browser
Species Human (GRCh38)
Location 17:81322368-81322390
Sequence TCCAGAAGGCGGGTGGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152612415 Original CRISPR TCCAGAAGGCGGGTGGGCAC CGG (reversed) Intronic
900110609 1:1003964-1003986 TCCAAATGGCGGGTGGCCCCGGG + Intergenic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900372106 1:2336702-2336724 TCCACAAGGTGGGTGCCCACGGG - Exonic
900640885 1:3687607-3687629 TCCACAAGGAGGGAGGACACAGG + Intronic
900653113 1:3740910-3740932 TCCAGAAGGTGCCTGGGCCCGGG - Intergenic
902518059 1:17000371-17000393 GCCATAAGGTGGGTGGGGACGGG - Intronic
904524394 1:31121786-31121808 TCCAGCAGGCTGGAGTGCACTGG - Intergenic
904947829 1:34212439-34212461 TCCAGAAAGCTGGTGGGAACGGG + Intronic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
906177844 1:43791172-43791194 TACAGAAGGGGAGTGGGTACTGG - Intronic
910435546 1:87201989-87202011 GCCAGGTGGCGGGTGGGCCCTGG - Intergenic
916518315 1:165540910-165540932 TCCAAAGGACAGGTGGGCACAGG - Intergenic
916791580 1:168129840-168129862 TGCAGAAGACAGGTAGGCACAGG + Intronic
920052049 1:203170280-203170302 TCCAGAAGGCAGGTGGGTTTGGG - Exonic
920569889 1:207008617-207008639 TCCAGAAGGAAGCTGGGCACAGG + Intronic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
921070945 1:211656972-211656994 ACCAGAAGGGGCCTGGGCACAGG + Intergenic
1065119793 10:22517224-22517246 GCCAGGAGGCGGGGGGGCAGGGG - Intergenic
1067732013 10:48819315-48819337 TGCAGAAGGCTGGTGGCCAAAGG + Intronic
1068411983 10:56667758-56667780 ACCAGCAGGTGAGTGGGCACTGG + Intergenic
1069659905 10:70116792-70116814 ACCAGGAGGCTGGTGGGGACAGG + Intronic
1072739721 10:97902088-97902110 GTCAGAAGCTGGGTGGGCACCGG + Intronic
1074055943 10:109923179-109923201 TCCGGAGGGTCGGTGGGCACGGG - Intronic
1074943051 10:118253835-118253857 ACCAGAAGGCGGGTGAAGACAGG + Intergenic
1076691881 10:132227916-132227938 TCCTGAAGCCGGGAAGGCACTGG - Intronic
1077009362 11:373343-373365 CCCAAGAGGCTGGTGGGCACAGG - Intronic
1077112243 11:866938-866960 TCCAGGAGGCTGGGGGCCACAGG - Exonic
1077362051 11:2145155-2145177 TGCAGAAGGCTGGTGGGAAGGGG - Intronic
1079312022 11:19375335-19375357 CCCAGAAGATGGCTGGGCACAGG + Intronic
1079373607 11:19872711-19872733 TCCAGCAGGCGGGTCGGGGCAGG - Intronic
1081659774 11:44880909-44880931 TCCAGAGGGCTGCTGGGCAAAGG + Intronic
1083155492 11:60820537-60820559 TTCAGAAGGCAGGTGGGCTGTGG - Intergenic
1088648399 11:111936797-111936819 ACCAGAAGGTGGGTGGGAAAGGG - Intronic
1089583803 11:119497462-119497484 ACCAGAAAGGGGGTGCGCACAGG + Intergenic
1090274140 11:125407979-125408001 TCCAGAAGCAGCGTGGGCACTGG - Intronic
1091364007 11:135001788-135001810 TCCAGAAGGCTGGGTGGCAGTGG + Intergenic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1096193357 12:49633974-49633996 TCCAGGAGGCCTGTGGGCACTGG - Exonic
1096395980 12:51267237-51267259 TTCAGGAAGCGGGTGGGCAGAGG - Intronic
1101349550 12:103916171-103916193 ACCAGAAGGCAAGTGGGCACAGG + Intergenic
1102109014 12:110349874-110349896 GCCAGAAGCCGGGTGCCCACAGG + Intronic
1103188735 12:118982331-118982353 TCCAGAGGGCAGGTGGGCCAAGG + Intronic
1104990425 12:132621218-132621240 TGCAGAGGACGAGTGGGCACTGG + Intronic
1105928659 13:25032302-25032324 GCCAGAAGGCGCATGGGCTCGGG - Intergenic
1109288005 13:60434836-60434858 TCCACCAGGTGGGTGTGCACAGG + Intronic
1112443130 13:99439558-99439580 TGTAGAAGGACGGTGGGCACTGG - Intergenic
1113432364 13:110261929-110261951 TGCACAGGGCAGGTGGGCACAGG + Intronic
1113649810 13:112027383-112027405 CCCAGGAGTCGGGTGGGGACAGG + Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1117297261 14:54391760-54391782 TCCAGAAAGTGGGTGGGCTGTGG - Intergenic
1119620818 14:76130806-76130828 CCCAGAAGGTGGGTGGGAAAGGG - Intergenic
1120141592 14:80935509-80935531 TCCAGAAGGCTGGAGTGCAGTGG - Intronic
1121052922 14:90831120-90831142 TCCAGAAGGCGGGCAGGGGCTGG + Intergenic
1121304680 14:92898675-92898697 TACAGAAGGCAGGCTGGCACTGG - Intergenic
1122356175 14:101124286-101124308 TCCAGAGGGCTGGTGAGAACTGG + Intergenic
1122873312 14:104651209-104651231 TCCAGAAGGAGGGCGTGGACGGG + Intergenic
1122906629 14:104804726-104804748 TCCTGAGGACGGGTGGGAACAGG + Intergenic
1124687273 15:31793017-31793039 GACAGATGGCGTGTGGGCACAGG + Intronic
1128564998 15:68695273-68695295 TCCCGGAGGAGGGTGGGCTCAGG + Intronic
1129245534 15:74276670-74276692 GCCAGGAGGCTGGAGGGCACAGG - Intronic
1132359615 15:101201550-101201572 TCCAGCAGGCGGTTGGGCAGTGG + Intronic
1132685219 16:1159287-1159309 TCCATGAGCCCGGTGGGCACAGG + Intronic
1133976344 16:10602080-10602102 CCCAGAAGGCCTGTGGGAACTGG - Intergenic
1137693657 16:50447028-50447050 TCCAGTTGGCAGGTGGGCAGAGG - Intergenic
1139486118 16:67257509-67257531 TCTAGAAGGGGGGTGGGTAGGGG - Exonic
1139890602 16:70251308-70251330 TCCAGGAGCCAGGTGGGCGCGGG + Exonic
1141659859 16:85435951-85435973 CCCAGAAGGCAGGTGGGGTCTGG + Intergenic
1142109296 16:88322763-88322785 TCCTGAAGGTGGGTGGGCACGGG - Intergenic
1142114157 16:88347795-88347817 CCCAGGAGGCGGGTGGGTGCTGG - Intergenic
1145280032 17:21460566-21460588 TGCTGAAGGCTGGTGGACACTGG + Intergenic
1145923140 17:28626499-28626521 TCCAGATGGTGGCTGGTCACTGG + Intronic
1146676421 17:34776467-34776489 ACCCGAAGGCTGTTGGGCACAGG - Intergenic
1147646535 17:42037819-42037841 TGCAGAGGCCGGGTGGGCAGGGG + Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148683349 17:49486999-49487021 GCCTGGAGGCTGGTGGGCACTGG - Intergenic
1150452229 17:65278713-65278735 TCCAGCAGGCCTGTGGGCACAGG + Intergenic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1152739314 17:82012079-82012101 TGCAGCAGGAGTGTGGGCACAGG + Intronic
1152743407 17:82028497-82028519 TCCAGGCCGAGGGTGGGCACGGG + Exonic
1156453322 18:37279021-37279043 TGGAGGAGGAGGGTGGGCACGGG - Intronic
1157492737 18:48135947-48135969 GCCGGCAGGCGGGTGGGCAGCGG - Intronic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160673114 19:375652-375674 TCCTGAAATCAGGTGGGCACCGG - Exonic
1161321434 19:3643480-3643502 TCTGGGAGGCGGGCGGGCACTGG - Intronic
1163020076 19:14477076-14477098 TCCAAAAGGCGGGCGGGCACTGG - Intergenic
1163826677 19:19528129-19528151 TCCAGGTGGCCGGAGGGCACAGG - Exonic
1164603624 19:29580083-29580105 TCCAGAAGGCAGCTGTGCAGAGG - Intergenic
1167867882 19:52343028-52343050 TCCAGAACACGAGTGGACACAGG - Intronic
1168649688 19:58085362-58085384 TCCAGAAGGCGGGAGGCGGCAGG - Exonic
925917571 2:8617699-8617721 TCCAGCAGCCGGGTGGCCGCAGG + Intergenic
929172537 2:38946159-38946181 TCCAGCAGGCGGGAGGTCATAGG + Intronic
930691717 2:54371748-54371770 CCCACAATGTGGGTGGGCACAGG + Intronic
934555303 2:95284056-95284078 CCCAGAAGCCAGATGGGCACTGG + Intronic
935744498 2:106178828-106178850 TCAGGAAGGCTGGGGGGCACTGG - Intronic
936154691 2:110040302-110040324 TCCAGATGCCGGGAGGACACTGG + Intergenic
936189992 2:110331112-110331134 TCCAGATGCCGGGAGGACACTGG - Intergenic
938038226 2:128054118-128054140 TCCATTAGGAGGGTGGCCACAGG - Intergenic
938082207 2:128376275-128376297 TCCAGAAGGTGGGAGGGAGCTGG + Intergenic
939599676 2:144173615-144173637 TCCAGTAGGCTGGTGGGAACAGG + Intronic
939610291 2:144301710-144301732 TCCAGAAAGCATGTGGGCATTGG - Intronic
946020303 2:216635882-216635904 TGCGGAAGGCGTCTGGGCACTGG - Intronic
948883875 2:240873517-240873539 TCCCGTAAGCGGATGGGCACAGG - Intronic
948893710 2:240918816-240918838 TCACGGATGCGGGTGGGCACGGG - Exonic
1169206270 20:3742005-3742027 TCCAGAGGGAGGGTGGGCAGAGG + Intronic
1172788452 20:37486094-37486116 TCCAGAAAGAGAGTGGCCACTGG + Intergenic
1173639536 20:44591107-44591129 TCCAGAGGGCTAGTGGGCAGAGG + Intronic
1174200789 20:48805121-48805143 GCCAGGAGGCTGGTGGGCACTGG - Intronic
1175418599 20:58817361-58817383 TCCGGAAGGGGAGCGGGCACCGG + Intergenic
1175460672 20:59149831-59149853 TCCAGCTGGCCGGTGTGCACAGG + Intergenic
1179551651 21:42147214-42147236 TCCAGCACGGGGGTGGGCAAGGG + Intergenic
1181108864 22:20589993-20590015 TCCAGAAAGCGGGAGGGCTTGGG + Intergenic
1181403757 22:22667497-22667519 TCCAGAGGGTGGGTGGTCCCTGG - Intergenic
1181932739 22:26415756-26415778 TGCAGAAGGTGGGTGGTCAGGGG - Intergenic
1181964368 22:26646262-26646284 TCCAGAAGGCAGGTAGGGACTGG - Intergenic
1182075836 22:27494923-27494945 TCCAGAAGGCCGAGGGGCAGGGG + Intergenic
1182519441 22:30876980-30877002 TGCAGAAGGTGGGTGGCCAGTGG - Intronic
1183379474 22:37483843-37483865 TCCAGAGGGGGCGGGGGCACAGG + Intronic
1184017258 22:41795535-41795557 TCCAGCAGGTGGGTGGGAAGGGG + Exonic
950655899 3:14435968-14435990 TCCAGAGGCCTGGTGGGCAAAGG - Intronic
952097273 3:29968436-29968458 TCCAGCAGGAGGGTGGCCAGAGG - Intronic
953271492 3:41449410-41449432 TCCAGAAGGCAGATGGGCGGTGG + Intronic
953472218 3:43177192-43177214 TCCAGCAGGCTGGTGGACACTGG + Intergenic
957449893 3:80366286-80366308 TCCAGGAGGCTGTTGGGCACTGG + Intergenic
961369401 3:126420222-126420244 TCCAGAGGGTGAGTGGGCTCGGG + Exonic
961535647 3:127568944-127568966 TCCAGAAGGCAGCTCGGCGCTGG + Intergenic
963062498 3:141235806-141235828 TCCAAAAGGCAGGAGGGCCCTGG + Intronic
963270705 3:143283287-143283309 TGTAGGAGACGGGTGGGCACTGG + Intronic
965616347 3:170596704-170596726 TCCAGAACTTTGGTGGGCACAGG - Intronic
965716454 3:171609742-171609764 TCCAAAAGGTGGGTGGGTAGAGG + Intronic
968578071 4:1377125-1377147 TCCAGAGAGCGGGGGGGCAGGGG + Intronic
970410160 4:15798230-15798252 TCCAGAAGTGGGGTGGTCATAGG + Intronic
973158993 4:46993132-46993154 TCCAAGAGGCGTGTGGGCACTGG - Intronic
973606636 4:52593602-52593624 CCCAGAAGGAGGGCAGGCACAGG - Exonic
973954354 4:56048861-56048883 TGCAGAAGCCGGGAGGGCACTGG + Intergenic
978495860 4:109358490-109358512 TCACTAAGGTGGGTGGGCACGGG + Intergenic
984925323 4:184801368-184801390 TGCAGAATGAGGGTGGGAACTGG + Intronic
987255694 5:16148554-16148576 TCCATAGGTCGGGTGGGGACAGG - Intronic
987315183 5:16717377-16717399 TCCAGAAGACGGATTGCCACTGG - Intronic
988990017 5:36661579-36661601 TGCAGAGTGTGGGTGGGCACAGG + Intronic
996646710 5:125826388-125826410 TCCAGAAGGAGAATGGGGACAGG - Intergenic
996789549 5:127277977-127277999 TCCAGGAGGCAGCTGGGCAGAGG + Intergenic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1002503737 5:179664697-179664719 TGCAGAAGCCTGGTGGCCACTGG - Intergenic
1003160217 6:3627979-3628001 TCCAAAAGGCGGGAGGTGACAGG + Intergenic
1006516098 6:34546616-34546638 TGCACAAGGAGGGTGGGCAGAGG - Intronic
1006621943 6:35371454-35371476 TCCAGCAGGCAGGTGGACACAGG - Intronic
1007288476 6:40765689-40765711 TCCAGAAGGAGGTCGGGGACAGG - Intergenic
1007923826 6:45635023-45635045 CACAGAAGGCTGGTGGGAACCGG + Intronic
1015585742 6:134774023-134774045 TCCAGAGTGCGGGGGGGCAGGGG - Intergenic
1016614234 6:146028407-146028429 TCCTGAAGGCGGCAGGGCTCAGG + Intronic
1019801174 7:3089482-3089504 GCCAGAAGGTGGGAGGGCAGGGG - Intergenic
1020707356 7:11561999-11562021 TCCAGGAGTTGGGTGGGAACTGG - Intronic
1023862160 7:44223360-44223382 TCCACCAGGTGGGTGGGAACTGG - Intronic
1024103359 7:46056602-46056624 TCCAGAAGGCTCCTGGGCACAGG - Intergenic
1024225717 7:47325365-47325387 TGGAGAAGGCAGGTGGGTACCGG - Intronic
1026163555 7:67890462-67890484 CCCAGATGGTGGGTGGGCAGAGG - Intergenic
1029530547 7:101122403-101122425 GCCAGAAGGCGGGAGGTCAGGGG + Intergenic
1032087526 7:128891671-128891693 CCCAGGCAGCGGGTGGGCACAGG + Exonic
1034840080 7:154387491-154387513 CCCAGCAGGTGGGTGGGCCCAGG + Intronic
1035189327 7:157152134-157152156 GCCAGAATGGGGGTGGGCAAAGG + Intronic
1035345196 7:158192854-158192876 GCCAGAGGCCGGGTGGGCATGGG + Intronic
1036799714 8:11781273-11781295 TTCAGAAGGAGGGTGGGCTTTGG + Intronic
1037009150 8:13819247-13819269 TGCAGAAGGCCTGTGGGCCCAGG - Intergenic
1038168989 8:25111460-25111482 CCCAGTAGGCAGCTGGGCACGGG - Intergenic
1038587162 8:28800306-28800328 TGCAGGAGGCGGGAGGGCATGGG + Intronic
1038593318 8:28861266-28861288 ACCAGATGGAGGGTGGGGACAGG - Intronic
1046498384 8:115043333-115043355 TCCATAAGGAGGGTGGCCAGAGG + Intergenic
1049405374 8:142449879-142449901 TCCAGCAGGCGCGGGGGAACGGG + Exonic
1049664230 8:143835907-143835929 CCCAGGCGGCGGGTGGGCAGCGG - Intronic
1053168359 9:35860527-35860549 TCCGGAAGGCAGGTGGGTAATGG + Intergenic
1053509807 9:38678109-38678131 TCCATGAGGAGGGTGGGGACAGG + Intergenic
1056554327 9:87676399-87676421 ACCAGATGGCGGGTAGGGACGGG - Intronic
1057186781 9:93061577-93061599 TCCACATGGAGGGTGAGCACAGG - Intronic
1057337404 9:94166534-94166556 TCCAGCGGGCGGGTGGCCCCGGG + Intergenic
1060547889 9:124471337-124471359 GCCAAAAGGTGGGTGGGCAAGGG + Intronic
1061512574 9:131069984-131070006 GCCTGAAGCTGGGTGGGCACAGG - Intronic
1061599259 9:131655896-131655918 TCTAAAAGGGGGGTGTGCACTGG + Intronic
1062214949 9:135384142-135384164 TCCAGAGGGGGGCTGGGCTCTGG + Intergenic
1062413625 9:136437177-136437199 ACCAGCAGGCAGGTGGGCTCAGG - Intronic
1203561853 Un_KI270744v1:64289-64311 GCCAGAAGGCCGGCTGGCACGGG - Intergenic
1186163383 X:6801649-6801671 TTCAGAACGCTGGTGGCCACAGG - Intergenic
1186482348 X:9905523-9905545 TCCAGAAGGCCGGAGGGCGAGGG + Intronic
1189302037 X:39958987-39959009 TCCAGTAGGCGTGTGCTCACAGG - Intergenic
1200071722 X:153532504-153532526 TCCAGAAGGCGGTTGAGTAATGG + Intronic