ID: 1152616811

View in Genome Browser
Species Human (GRCh38)
Location 17:81341663-81341685
Sequence GGCTCCAGTGGAGGACGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152616796_1152616811 11 Left 1152616796 17:81341629-81341651 CCCCACGGGCCGCACTCGCCGAG No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616806_1152616811 -7 Left 1152616806 17:81341647-81341669 CCGAGGGGCCGAAAGGGGCTCCA No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616795_1152616811 16 Left 1152616795 17:81341624-81341646 CCACTCCCCACGGGCCGCACTCG No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616794_1152616811 17 Left 1152616794 17:81341623-81341645 CCCACTCCCCACGGGCCGCACTC No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616799_1152616811 9 Left 1152616799 17:81341631-81341653 CCACGGGCCGCACTCGCCGAGGG No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616797_1152616811 10 Left 1152616797 17:81341630-81341652 CCCACGGGCCGCACTCGCCGAGG No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616793_1152616811 23 Left 1152616793 17:81341617-81341639 CCGACGCCCACTCCCCACGGGCC No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616790_1152616811 30 Left 1152616790 17:81341610-81341632 CCTCGCGCCGACGCCCACTCCCC No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data
1152616802_1152616811 2 Left 1152616802 17:81341638-81341660 CCGCACTCGCCGAGGGGCCGAAA No data
Right 1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152616811 Original CRISPR GGCTCCAGTGGAGGACGCGG TGG Intergenic
No off target data available for this crispr