ID: 1152617707

View in Genome Browser
Species Human (GRCh38)
Location 17:81345623-81345645
Sequence CGCTCCGAGGGCGGCCTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152617707 Original CRISPR CGCTCCGAGGGCGGCCTCGC GGG Intergenic