ID: 1152618458

View in Genome Browser
Species Human (GRCh38)
Location 17:81348725-81348747
Sequence GTCTGACCACGTGCTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152618456_1152618458 -3 Left 1152618456 17:81348705-81348727 CCGTCAGCCACAGTTGAGGTGTC No data
Right 1152618458 17:81348725-81348747 GTCTGACCACGTGCTGCTGATGG No data
1152618457_1152618458 -10 Left 1152618457 17:81348712-81348734 CCACAGTTGAGGTGTCTGACCAC No data
Right 1152618458 17:81348725-81348747 GTCTGACCACGTGCTGCTGATGG No data
1152618452_1152618458 29 Left 1152618452 17:81348673-81348695 CCTGGAGGGAGCGGGGAGTCGTG No data
Right 1152618458 17:81348725-81348747 GTCTGACCACGTGCTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152618458 Original CRISPR GTCTGACCACGTGCTGCTGA TGG Intergenic