ID: 1152622565

View in Genome Browser
Species Human (GRCh38)
Location 17:81372625-81372647
Sequence GCTCAAGGAGGTCAGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152622565_1152622577 24 Left 1152622565 17:81372625-81372647 CCGGCCGCCTGACCTCCTTGAGC No data
Right 1152622577 17:81372672-81372694 TGAGTTGCAGTGGAACCTGCTGG No data
1152622565_1152622574 14 Left 1152622565 17:81372625-81372647 CCGGCCGCCTGACCTCCTTGAGC No data
Right 1152622574 17:81372662-81372684 CGCAGAGCCCTGAGTTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152622565 Original CRISPR GCTCAAGGAGGTCAGGCGGC CGG (reversed) Intergenic
No off target data available for this crispr