ID: 1152627136

View in Genome Browser
Species Human (GRCh38)
Location 17:81393069-81393091
Sequence CCGTGGGGCCCAGTCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152627136_1152627142 -4 Left 1152627136 17:81393069-81393091 CCAGGAGAGACTGGGCCCCACGG No data
Right 1152627142 17:81393088-81393110 ACGGTGTTAGCCCCGCGCTCGGG No data
1152627136_1152627141 -5 Left 1152627136 17:81393069-81393091 CCAGGAGAGACTGGGCCCCACGG No data
Right 1152627141 17:81393087-81393109 CACGGTGTTAGCCCCGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152627136 Original CRISPR CCGTGGGGCCCAGTCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr