ID: 1152627299

View in Genome Browser
Species Human (GRCh38)
Location 17:81393600-81393622
Sequence GTCTCCCGGCTCCGGCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152627299_1152627308 -4 Left 1152627299 17:81393600-81393622 CCCGGCCGCCGGAGCCGGGAGAC No data
Right 1152627308 17:81393619-81393641 AGACGCCGGAGACGGGAGCCGGG No data
1152627299_1152627307 -5 Left 1152627299 17:81393600-81393622 CCCGGCCGCCGGAGCCGGGAGAC No data
Right 1152627307 17:81393618-81393640 GAGACGCCGGAGACGGGAGCCGG No data
1152627299_1152627313 27 Left 1152627299 17:81393600-81393622 CCCGGCCGCCGGAGCCGGGAGAC No data
Right 1152627313 17:81393650-81393672 ACCGCCACTCCCGAGCCAGCCGG No data
1152627299_1152627316 29 Left 1152627299 17:81393600-81393622 CCCGGCCGCCGGAGCCGGGAGAC No data
Right 1152627316 17:81393652-81393674 CGCCACTCCCGAGCCAGCCGGGG No data
1152627299_1152627315 28 Left 1152627299 17:81393600-81393622 CCCGGCCGCCGGAGCCGGGAGAC No data
Right 1152627315 17:81393651-81393673 CCGCCACTCCCGAGCCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152627299 Original CRISPR GTCTCCCGGCTCCGGCGGCC GGG (reversed) Intergenic
No off target data available for this crispr