ID: 1152627372

View in Genome Browser
Species Human (GRCh38)
Location 17:81393820-81393842
Sequence AATCCCGGAGTCCCCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152627360_1152627372 21 Left 1152627360 17:81393776-81393798 CCCGAAGCGGGCGCCGGCGTAGG No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627362_1152627372 20 Left 1152627362 17:81393777-81393799 CCGAAGCGGGCGCCGGCGTAGGC No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627359_1152627372 24 Left 1152627359 17:81393773-81393795 CCGCCCGAAGCGGGCGCCGGCGT No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627369_1152627372 -3 Left 1152627369 17:81393800-81393822 CCCGACTCAGGCAGGCGGGAAAT No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627364_1152627372 8 Left 1152627364 17:81393789-81393811 CCGGCGTAGGCCCCGACTCAGGC No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627370_1152627372 -4 Left 1152627370 17:81393801-81393823 CCGACTCAGGCAGGCGGGAAATC No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627368_1152627372 -2 Left 1152627368 17:81393799-81393821 CCCCGACTCAGGCAGGCGGGAAA No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data
1152627357_1152627372 29 Left 1152627357 17:81393768-81393790 CCGAGCCGCCCGAAGCGGGCGCC No data
Right 1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152627372 Original CRISPR AATCCCGGAGTCCCCGCCCG CGG Intergenic
No off target data available for this crispr