ID: 1152627421

View in Genome Browser
Species Human (GRCh38)
Location 17:81393948-81393970
Sequence CTCCGCCGCACCTCGGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152627414_1152627421 10 Left 1152627414 17:81393915-81393937 CCTTTCTCTCCAGATTCCTTTGA No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627411_1152627421 18 Left 1152627411 17:81393907-81393929 CCGCTTCCCCTTTCTCTCCAGAT No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627417_1152627421 1 Left 1152627417 17:81393924-81393946 CCAGATTCCTTTGATCCGCGGGC No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627409_1152627421 22 Left 1152627409 17:81393903-81393925 CCGCCCGCTTCCCCTTTCTCTCC No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627418_1152627421 -6 Left 1152627418 17:81393931-81393953 CCTTTGATCCGCGGGCTCTCCGC No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627412_1152627421 12 Left 1152627412 17:81393913-81393935 CCCCTTTCTCTCCAGATTCCTTT No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627410_1152627421 19 Left 1152627410 17:81393906-81393928 CCCGCTTCCCCTTTCTCTCCAGA No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627413_1152627421 11 Left 1152627413 17:81393914-81393936 CCCTTTCTCTCCAGATTCCTTTG No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data
1152627408_1152627421 26 Left 1152627408 17:81393899-81393921 CCGGCCGCCCGCTTCCCCTTTCT No data
Right 1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152627421 Original CRISPR CTCCGCCGCACCTCGGCTCC CGG Intergenic
No off target data available for this crispr