ID: 1152627974

View in Genome Browser
Species Human (GRCh38)
Location 17:81396939-81396961
Sequence TCCAGGAGAGGCCGCGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 141}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152627974_1152627984 0 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627984 17:81396962-81396984 GCTGGGCTGGGAGTGGGCCCCGG 0: 1
1: 1
2: 13
3: 143
4: 1068
1152627974_1152627985 1 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627985 17:81396963-81396985 CTGGGCTGGGAGTGGGCCCCGGG 0: 1
1: 0
2: 8
3: 93
4: 817
1152627974_1152627983 -6 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627983 17:81396956-81396978 CCTGGAGCTGGGCTGGGAGTGGG 0: 1
1: 0
2: 12
3: 137
4: 1037
1152627974_1152627987 14 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627987 17:81396976-81396998 GGGCCCCGGGCCTCGGCACTCGG 0: 1
1: 0
2: 1
3: 15
4: 185
1152627974_1152627991 18 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627991 17:81396980-81397002 CCCGGGCCTCGGCACTCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 141
1152627974_1152627989 17 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627989 17:81396979-81397001 CCCCGGGCCTCGGCACTCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 148
1152627974_1152627981 -7 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627981 17:81396955-81396977 TCCTGGAGCTGGGCTGGGAGTGG 0: 1
1: 0
2: 10
3: 127
4: 1002
1152627974_1152627993 21 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627993 17:81396983-81397005 GGGCCTCGGCACTCGGCGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1152627974_1152627986 7 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627986 17:81396969-81396991 TGGGAGTGGGCCCCGGGCCTCGG 0: 1
1: 0
2: 3
3: 46
4: 422
1152627974_1152627995 24 Left 1152627974 17:81396939-81396961 CCTCCGGCGCGGCCTCTCCTGGA 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1152627995 17:81396986-81397008 CCTCGGCACTCGGCGGGTGGCGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152627974 Original CRISPR TCCAGGAGAGGCCGCGCCGG AGG (reversed) Intronic