ID: 1152630962

View in Genome Browser
Species Human (GRCh38)
Location 17:81410528-81410550
Sequence CCTGGGGCGTTGGATGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152630955_1152630962 -7 Left 1152630955 17:81410512-81410534 CCACCCTCCAGCATGTCCTGGGG 0: 1
1: 0
2: 4
3: 49
4: 472
Right 1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG 0: 1
1: 0
2: 0
3: 42
4: 346
1152630957_1152630962 -10 Left 1152630957 17:81410515-81410537 CCCTCCAGCATGTCCTGGGGCGT 0: 1
1: 0
2: 0
3: 17
4: 115
Right 1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG 0: 1
1: 0
2: 0
3: 42
4: 346
1152630953_1152630962 -6 Left 1152630953 17:81410511-81410533 CCCACCCTCCAGCATGTCCTGGG 0: 1
1: 0
2: 3
3: 44
4: 406
Right 1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG 0: 1
1: 0
2: 0
3: 42
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152630962 Original CRISPR CCTGGGGCGTTGGATGTGAC TGG Intronic
900463735 1:2813619-2813641 CCTTGGGCGGTCGATGGGACTGG - Intergenic
900763727 1:4489564-4489586 CCTGGGGAGTTGGACCTGAGAGG - Intergenic
901883614 1:12208118-12208140 GGTGGGGGGTTGGATGTGGCTGG - Exonic
902032564 1:13433859-13433881 CCTTGGGCGGTCGATGGGACTGG + Intergenic
903022411 1:20403596-20403618 TCTGGGGGGATGGATGTCACAGG - Intergenic
903028528 1:20446370-20446392 GCTGGGGTGATGGAAGTGACTGG + Intergenic
903065485 1:20697040-20697062 CCTCGGGCGCTGCACGTGACGGG - Intronic
904354783 1:29931902-29931924 TCTGGGGCCTTGGCTGTTACGGG + Intergenic
905168661 1:36098062-36098084 CCTGGGGCCTTCGATGAGACTGG - Exonic
906066445 1:42984593-42984615 CCTGGGGCCATGGAAGGGACTGG - Intergenic
907102181 1:51847390-51847412 CCTTGGGCGATGGATGGGACTGG + Intronic
909317972 1:74247912-74247934 CCTTGGGTGGTGGATGGGACTGG + Intronic
910622608 1:89273376-89273398 CCTTGGGCCATGGATGGGACAGG + Intergenic
910912015 1:92245248-92245270 CCTAGGGGGTTGGAGGTGTCTGG - Intronic
911001500 1:93170577-93170599 CCTTGGGCGGTTGATGGGACTGG - Intronic
912538697 1:110396341-110396363 CCTTGGGCGGTGGATGGGACCGG + Intergenic
915463664 1:156083353-156083375 CCTTGAGCTTTGGATATGACAGG + Intronic
916605895 1:166342872-166342894 CCTTGGGCAGTGGATGGGACTGG + Intergenic
916807016 1:168269172-168269194 GCTGGAGCGTTGGGTGGGACTGG + Intergenic
918002300 1:180508952-180508974 CCTTGGGCGGTAGATGGGACCGG - Intergenic
918793229 1:188858004-188858026 CCTTGGGCGGTGGATGGGACTGG - Intergenic
918853154 1:189718311-189718333 CCTTGGGCGGTCGATGGGACTGG + Intergenic
920746235 1:208631665-208631687 CCTGGGGAGCTGGATGGGAAGGG - Intergenic
922306923 1:224352531-224352553 CCTTGGGTGGTGGATGGGACTGG + Intergenic
923621337 1:235581886-235581908 CCTGGGGCGGTGTCTGTGGCAGG + Intronic
924219178 1:241855592-241855614 CCTTGGGTGGTGGATGAGACTGG + Intronic
1062855604 10:778100-778122 CCTGGGGCTGTGCAGGTGACTGG + Intergenic
1063148892 10:3319826-3319848 CCTTGGGCGGTTGATGGGACCGG + Intergenic
1065511177 10:26479971-26479993 CCTGGGCCTTTGGATGCCACAGG - Intronic
1066391667 10:34981653-34981675 CCTGTGGCTTTGGTTGTTACTGG + Intergenic
1068460415 10:57321824-57321846 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1068792328 10:61040962-61040984 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1068863228 10:61867992-61868014 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1070642021 10:78177154-78177176 CATGAGGCGCTGGATGTGCCTGG + Intergenic
1070942510 10:80359509-80359531 CCTTGGGCGGTCGATGGGACCGG + Intronic
1071332239 10:84571545-84571567 CCTTGGGCGGTTGATGGGACCGG - Intergenic
1071528038 10:86369307-86369329 CCAGGGGCATTGGATGTTATTGG + Intergenic
1071610951 10:87030998-87031020 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1073425724 10:103454514-103454536 CCTGGAGACCTGGATGTGACGGG + Exonic
1073878352 10:107950885-107950907 CCTTGGGCGGTTGATGGGACCGG - Intergenic
1074115927 10:110457554-110457576 CCTGAGGAGTAGGAGGTGACTGG + Intergenic
1075504946 10:123013514-123013536 CCTTGGGCGGTTGATGGGACTGG + Intronic
1076688200 10:132207710-132207732 GCTGGGGCCATGGATGGGACAGG - Exonic
1076830281 10:132991086-132991108 CATGGGGAATTGGATGTAACGGG - Intergenic
1077150515 11:1071059-1071081 CCTGGAGAGCTGGACGTGACTGG + Intergenic
1079494124 11:21022021-21022043 ACTGGGGCAGGGGATGTGACTGG - Intronic
1081315255 11:41623185-41623207 TCTTGGGCGGTGGATGAGACTGG - Intergenic
1081324414 11:41728103-41728125 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1081329651 11:41788237-41788259 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1081420957 11:42874261-42874283 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1081710467 11:45212626-45212648 CCTGGGGCGAGGGATGGGGCAGG - Intronic
1082882035 11:58047256-58047278 CCTGGAGCTTGGGATGTGAGAGG + Intronic
1082912269 11:58390582-58390604 CCTTGGGTGGTGGATGGGACTGG + Intergenic
1082924677 11:58532291-58532313 CCTTGGGCGGTCGATGGGACTGG - Intronic
1083257113 11:61503302-61503324 CCTGGGGCCTGGGATGGGAAAGG + Intergenic
1084272375 11:68036196-68036218 CCTGGGGGCTGGGATGTGACAGG + Intronic
1084708840 11:70831474-70831496 CACGGGGCTTTGGATGTCACTGG - Intronic
1086087625 11:82971022-82971044 CCTTGGGCGGTCGATGGGACCGG - Intergenic
1088599862 11:111464460-111464482 GCTGTAGCATTGGATGTGACAGG - Intergenic
1088748583 11:112824783-112824805 ACTGGGGCTTTGGAAGTCACAGG + Intergenic
1089524131 11:119085571-119085593 CTTGGAGCGTTGGCTGTGGCTGG - Intronic
1089800301 11:121022008-121022030 CCTTGGGTGGTGGAAGTGACTGG - Intergenic
1090588302 11:128237393-128237415 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1090701410 11:129299095-129299117 TCTGGGGCTGGGGATGTGACAGG + Intergenic
1092336738 12:7640187-7640209 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1093741315 12:22693050-22693072 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1094722102 12:33075652-33075674 CCTTGGGCGGTCGATGAGACCGG - Intergenic
1094820101 12:34217904-34217926 CCAGGGCCGTTGGATATGGCAGG - Intergenic
1094833252 12:34310041-34310063 CCTTGAGCGGTGGATGGGACTGG - Intergenic
1095094641 12:38139576-38139598 CCAGGGCCGTTGGATATGGCAGG + Intergenic
1095407387 12:41881864-41881886 CCTGTGGATTTGGAAGTGACTGG - Intergenic
1095444903 12:42273720-42273742 CCTTGGGCGGTCGATGGGACCGG + Intronic
1095587468 12:43864247-43864269 CCTTGGGCGGTGGGTGGGACTGG - Intronic
1097250996 12:57632304-57632326 CCTGGGGCCTGGGAAGTGAGGGG - Intronic
1097863969 12:64543602-64543624 CCTTGGGCAGTGGATGGGACCGG - Intergenic
1098253485 12:68592740-68592762 CCTGGGGCTTAGGATGAGACTGG - Intergenic
1098588735 12:72185394-72185416 CCTTGGGTGGTGGATGGGACTGG - Intronic
1098759296 12:74403295-74403317 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1099192485 12:79574220-79574242 CCTTGGGCGGTTGATGGGACTGG - Intergenic
1099716175 12:86296414-86296436 CCTTGGGCGGTCGATGGGACTGG + Intronic
1101148915 12:101866906-101866928 CCTGGGGCTTTGGAAGTTGCAGG + Intergenic
1101589713 12:106114811-106114833 TCTGGGGACTTGGCTGTGACTGG - Intronic
1104128597 12:125871378-125871400 CTTGGGGTGTTGGGTGGGACAGG + Intergenic
1105777584 13:23677841-23677863 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1105876629 13:24560718-24560740 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1106643377 13:31608841-31608863 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1109007817 13:56901078-56901100 CCTTGGGTGGTGGATGGGACCGG - Intergenic
1109110960 13:58318547-58318569 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1109506202 13:63306080-63306102 CCTTGGGCGGTCGATGGGACCGG - Intergenic
1109741579 13:66561372-66561394 CCTTGGGTGGTGGATGGGACTGG - Intronic
1109854239 13:68107731-68107753 CCTTGAGCGGTGGATGGGACCGG + Intergenic
1110609771 13:77475508-77475530 CCTTGGGTGGTGGATGGGACTGG + Intergenic
1110751343 13:79119649-79119671 CCTTGGGTGTTTGATGGGACTGG + Intergenic
1111138738 13:84086426-84086448 CCTTGAGCGGTGGATGGGACTGG + Intergenic
1111333609 13:86792562-86792584 CCTTGGGCGGTAGATGGGACCGG - Intergenic
1111556121 13:89883878-89883900 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1113294824 13:108947419-108947441 CCTGGGGAGCTGCATCTGACTGG - Intronic
1115268575 14:31527094-31527116 CCTTGGGGGTTTGATGGGACGGG + Intronic
1115284317 14:31700898-31700920 CCTTGGGCGGTCGATGGGACCGG - Intronic
1116118229 14:40685268-40685290 CCTGGGGCCTTGAATAAGACAGG - Intergenic
1116311065 14:43326951-43326973 CCTTGGGCGATCGATGGGACAGG - Intergenic
1117183585 14:53217532-53217554 CCTTGGGCAGTGGATGGGACCGG + Intergenic
1117297419 14:54392991-54393013 CCTTGGGCGGTGGATGGGACCGG + Intergenic
1117837202 14:59819611-59819633 CCTTGGGCGGTCGATGGGACCGG + Intronic
1119303634 14:73590490-73590512 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1120891597 14:89496512-89496534 CCTTGGGCTTTGGAAGTGAAAGG + Intronic
1122216471 14:100208178-100208200 CCTTGGGCGGTTGATGGGACCGG + Intergenic
1122246271 14:100405484-100405506 CCTGGGGCCTAGGATGGGGCTGG + Intronic
1122894771 14:104751536-104751558 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1123721251 15:23063813-23063835 CCTTGGGGGATGGATGTCACTGG - Intergenic
1124123432 15:26912098-26912120 CCTGTGGCCTTGGCTGTAACAGG - Intronic
1124818420 15:33019493-33019515 CCTTGGGCGGTCGATGGGACCGG + Intronic
1125418406 15:39477305-39477327 CCTGGGCCTCTGGATTTGACTGG - Intergenic
1127727825 15:61767795-61767817 CCTGGGCAGCTGGATGTGCCAGG - Intergenic
1128594055 15:68928966-68928988 CCTTGGGCGGTCGATGGGACTGG + Intronic
1128813250 15:70587186-70587208 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1129121159 15:73397583-73397605 CCTGAGGAGCTGGCTGTGACTGG + Intergenic
1129158213 15:73732197-73732219 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1129266192 15:74394583-74394605 CCTGGGGAGTTTGGTGGGACCGG - Intergenic
1129280340 15:74480357-74480379 CCTTGGGTGGTGGATGGGACTGG + Intergenic
1129777446 15:78246149-78246171 CCTTGGGTGTTCGATGGGACTGG + Intergenic
1130041695 15:80410367-80410389 CCTGGGTGGTTGGAGGTGACAGG + Intronic
1130323043 15:82855904-82855926 TCTGTGGCGCTGAATGTGACTGG + Intronic
1131472777 15:92711071-92711093 CCTTGGGTGGTCGATGTGACTGG + Intronic
1133814228 16:9184212-9184234 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1134678091 16:16104680-16104702 CCTTGGGCGGTGGAAGGGACTGG + Intronic
1135470169 16:22723008-22723030 CCTTGGGCGGTGGATGGGACCGG + Intergenic
1137300482 16:47143847-47143869 CCTCGGGCGGTCGATGGGACGGG - Exonic
1138168894 16:54830164-54830186 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1139004875 16:62558445-62558467 CCTGGGGCAGTGGTAGTGACAGG - Intergenic
1139051535 16:63129981-63130003 CCTTGGGCGGTAGATGGGACCGG - Intergenic
1139349636 16:66327051-66327073 CTTTGGCCGATGGATGTGACCGG - Intergenic
1141768545 16:86074710-86074732 CCTGGGGTGCTGGAGGTGACTGG + Intergenic
1143708595 17:8718089-8718111 CCTTGGGCAGTGGATGGGACCGG + Intergenic
1144128139 17:12221212-12221234 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1144804621 17:17956508-17956530 CCTTGGGCGGTCGATGGGACCGG + Intronic
1145050242 17:19654324-19654346 CCTTGGGCGGTCGATGGGACTGG + Intronic
1148564329 17:48624503-48624525 CCTGGCAGGTTGGAGGTGACAGG + Intronic
1150097945 17:62395262-62395284 CCTGTGGAGTTGGATGTTAGTGG - Intronic
1150772336 17:68052220-68052242 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1150786702 17:68169370-68169392 CCTCGGGCGGTAGATGGGACTGG + Intergenic
1150788329 17:68180201-68180223 CCTTGGGCGATGGATGGGACCGG - Intergenic
1151438450 17:74113321-74113343 CCTTGGGCGGTAGATGGGACTGG + Intergenic
1151567409 17:74907055-74907077 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1151632136 17:75318375-75318397 CCTGGAGCGTTTGCTGTGCCAGG - Exonic
1152061788 17:78081700-78081722 TCTGGGCAGTGGGATGTGACTGG - Intronic
1152580849 17:81165092-81165114 CCTGGGGCCATGGATGGCACAGG + Intronic
1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG + Intronic
1153070438 18:1098580-1098602 CCTTGGGCAGTGGATGGGACCGG - Intergenic
1154177427 18:12094392-12094414 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154177482 18:12094538-12094560 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154219521 18:12440136-12440158 CCAGGGGCTCTGGGTGTGACTGG - Intergenic
1154942920 18:21132547-21132569 CCTTGGGCGGTGGATGGGATCGG + Intergenic
1155195616 18:23471389-23471411 CCTGGAGCATAGGATGTGAATGG + Intronic
1155294979 18:24376591-24376613 CCTTGGGTGGTGGATGGGACTGG + Intronic
1155611656 18:27673901-27673923 CCTTGGGCAGTGGATGGGACCGG + Intergenic
1156150366 18:34234192-34234214 CTTTGGGCGGTGGATGGGACTGG - Intergenic
1156476670 18:37409908-37409930 CCTGAGGCGCTGCATGTGAAGGG - Intronic
1156610448 18:38718436-38718458 CCTTGGGCGGTGGATGGGACAGG + Intergenic
1156713472 18:39977069-39977091 TCTGGGGCTTTGGAGGTCACAGG - Intergenic
1156969728 18:43139868-43139890 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1157685748 18:49640997-49641019 CCTGGGGAGGTGGGTGTGGCTGG + Intergenic
1158903876 18:61992066-61992088 CCTGGGGGCTTGAATGGGACAGG - Intergenic
1159260433 18:66005975-66005997 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1160176561 18:76600142-76600164 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1160968632 19:1757668-1757690 CCTGGGGCGTAAGAGGTGGCGGG + Intronic
1162061798 19:8100753-8100775 CCTGGGGAGTTGGAGGTGTGTGG + Intronic
1162107053 19:8376113-8376135 CCTTGGGTGGTGGATGGGACTGG - Intronic
1162193004 19:8961772-8961794 CCTGGGGGGTTGTATTTGATGGG + Exonic
1162636925 19:11976083-11976105 CCTGGGGTGTGGGATGTCCCAGG + Intronic
1164270536 19:23668539-23668561 CCTTGGGCGGTCGATGGGACTGG + Intronic
1164853228 19:31501563-31501585 CCTTGGGCCTGTGATGTGACAGG - Intergenic
1167062043 19:47155246-47155268 CCTGGGGCCTTGGAGGGGTCAGG + Intronic
1168354855 19:55694767-55694789 CCTGGGGCGTTTGACATGAGTGG + Exonic
1168507169 19:56946015-56946037 CCTGGAGACCTGGATGTGACAGG + Intergenic
925533032 2:4884564-4884586 CCTTGGGCAGTGGATGGGACTGG - Intergenic
926097547 2:10091766-10091788 CCTTGGGCGGTCGATGGGACCGG - Intergenic
928880631 2:36092588-36092610 CCTTGGGCGGTCGATGGGACTGG - Intergenic
930338708 2:50084233-50084255 CCTTGCGCGGTGGATGAGACTGG + Intronic
930485568 2:52007157-52007179 CCTTGGGTGGTGGATGGGACTGG - Intergenic
931190780 2:59998164-59998186 CCTGGTGAGCTGGATGTCACTGG + Intergenic
935414639 2:102802599-102802621 CCCGTGGCATTGGATGTGATAGG + Intronic
935866491 2:107392634-107392656 CCTTGGGCGGTGGATGGGACCGG - Intergenic
936865350 2:117071603-117071625 CCTTGGGCGGTCGATGGGACTGG + Intergenic
937608148 2:123826760-123826782 CCTTGGGCGGTCGATGGGACCGG + Intergenic
938241004 2:129742302-129742324 CCTGGGGCGCTGGATGTGTGGGG - Intergenic
938725974 2:134109358-134109380 CCTTGGGTGGTGGATGGGACTGG + Intergenic
939745369 2:145960585-145960607 CCTTGGGCGGTTGATGGGACTGG + Intergenic
940145606 2:150542334-150542356 CCTTGGGCGGTTGATGGGACTGG + Intergenic
940369007 2:152879278-152879300 GCTGGGAAGTTGGAAGTGACAGG + Intergenic
940784559 2:157967926-157967948 CCTTGGGTGGTGGATGGGACTGG + Intronic
941240140 2:163026624-163026646 CCTTGGGTGGTGGATGGGACTGG - Intergenic
942368605 2:175257012-175257034 CCTTGGGCGGTCGATGGGACCGG + Intergenic
943024261 2:182608746-182608768 CCTTGGGCGGTTGATGGGACTGG - Intergenic
943443353 2:187952064-187952086 CCTTGGGCGGTCGATGGGACTGG - Intergenic
944055226 2:195515976-195515998 CCTTGGGCGGTTGATGGGACTGG - Intergenic
944482846 2:200175087-200175109 CCTTGGGCGGTGGATGCGACTGG - Intergenic
945069685 2:205977533-205977555 CCTTGGGCCGTGGATGGGACTGG - Intergenic
945451443 2:210000628-210000650 CCTTGGGCGGTCGATGGGACTGG + Intergenic
945664167 2:212721081-212721103 CCTTGGGCGGTGGATGGGACTGG + Intergenic
946152707 2:217787277-217787299 CCTTGGGCGGTCGATGGGACCGG + Intergenic
948449060 2:238057867-238057889 CCTTGGGCGGTGGATGGTACTGG + Intronic
948820149 2:240538619-240538641 CCTTGGGTGGTGGATGGGACTGG - Intronic
1168812133 20:710893-710915 CCCGGGGCGGTGGAGGTGATGGG + Intergenic
1170230827 20:14044840-14044862 CCTTGGGCGGTCGATGGGACTGG + Intronic
1172444239 20:34984832-34984854 CCTGGGGCGGTGGGGGTGAGGGG - Exonic
1173207505 20:41006504-41006526 CCTGGGGGCTTGGATATGTCAGG + Intergenic
1175152730 20:56947728-56947750 CCTGATGCATTGGCTGTGACTGG + Intergenic
1177318767 21:19493891-19493913 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1180921257 22:19522768-19522790 CCTGGGGCCCGGGATGGGACAGG - Intergenic
1182479439 22:30597213-30597235 CCTTGGGCAGTTGATGTGACCGG - Intronic
1183664586 22:39239924-39239946 CCAGGGGCGTTGTCTGTGGCTGG + Intronic
1184584312 22:45437077-45437099 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1184647355 22:45903491-45903513 CCTGCGGCGTTGGCTTTGGCTGG + Intergenic
1184906193 22:47488318-47488340 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1185229063 22:49670213-49670235 CCTTGGGCGGTGGATGGGACTGG + Intergenic
949259033 3:2083976-2083998 CCTTGGGCGGTCGATGGGACTGG - Intergenic
949281542 3:2352734-2352756 CCTTGGGCGGTTGATGGGACTGG - Intronic
949875489 3:8623699-8623721 CCTGGAGCCTTGGAAGTCACTGG + Intronic
950203652 3:11061721-11061743 CCTTGGGCGGTGGATGGGACTGG - Intergenic
950204798 3:11071231-11071253 CCTTGGGCGGTCGATGGGACCGG + Intergenic
950256600 3:11511608-11511630 CCTTGGGCGGTCGATGGGACTGG + Intronic
950256907 3:11513257-11513279 CCTTGGGTGGTGGATGAGACTGG + Intronic
950400916 3:12768805-12768827 CCTTGGGCGGTCGATGGGACCGG + Intronic
950470215 3:13180065-13180087 CCTTGGGTGGTGGATGGGACTGG - Intergenic
950600327 3:14029507-14029529 CCTTGGGTGTTTGATGGGACTGG + Intronic
951734839 3:25852069-25852091 CCTTGGGTGGTGGATGGGACTGG - Intergenic
952593695 3:34988726-34988748 CCTTGGGTGGTGGATGGGACTGG - Intergenic
953002945 3:38951500-38951522 CCTTGGGCGGTCGATGGGACTGG - Intergenic
954089275 3:48271952-48271974 CCTTGGGCGGTCGATGGGACGGG + Intronic
954620191 3:51990921-51990943 CCTTGGGTGGTGGATGGGACTGG - Intergenic
955833913 3:63032812-63032834 CCTGGGGCGCATAATGTGACTGG - Intergenic
956195790 3:66651876-66651898 CCTTGGGTGGTGGATGGGACTGG - Intergenic
956632652 3:71331446-71331468 CCTTGGGCGGTCGATGGGACTGG - Intronic
957386497 3:79502570-79502592 CCTTGGGCAGTGGATGGGACTGG - Intronic
960487364 3:118270013-118270035 CCTTGGGCGGTTGATGGGACTGG - Intergenic
960669260 3:120140597-120140619 CCTTGGGCGGTCGATGGGACCGG - Intergenic
961807789 3:129501726-129501748 CCAGGGACGTTGGGTGTGATGGG + Intronic
962383709 3:134916367-134916389 CCTTGGGCGGTCGATGGGACCGG + Intronic
962671627 3:137714493-137714515 CCTTGGGCGGTTGATGGGACTGG + Intergenic
963862229 3:150323317-150323339 CCTTGGGCGGTCGATGGGACTGG - Intergenic
964982452 3:162702931-162702953 CCTTGGGCGGTCGATGGGACCGG + Intergenic
965109366 3:164401901-164401923 CCTTGGGCCGTGGATGGGACTGG + Intergenic
966425419 3:179775530-179775552 CCTTGGGCGGTCGATGGGACTGG + Intronic
966548921 3:181183042-181183064 CCTTGGGCGGTTGATGGGACTGG + Intergenic
967185316 3:186939779-186939801 CATGGGGCGTTGTGTGTGTCAGG - Intronic
970576813 4:17436574-17436596 CCTTGGGCGGTCGATGGGACTGG + Intergenic
971043296 4:22778619-22778641 CCTTGGGCGGTCGATGGGACTGG + Intergenic
973135308 4:46699202-46699224 CCTTGGGCGGTCGATGGGACCGG - Intergenic
973765038 4:54155135-54155157 CCTTGGGCGGTCGATGGGACTGG + Intronic
973854156 4:54993819-54993841 CCTTGGGCGGTCGATGGGACTGG - Intergenic
973878166 4:55241805-55241827 CCTTGGGTGGTGGATGGGACCGG - Intergenic
973981909 4:56314649-56314671 CCCGAGGCGTTGGAGGAGACTGG + Exonic
974992816 4:69115255-69115277 CCTTGGGCGATGGATGGGACTGG + Intronic
975028003 4:69576383-69576405 CCTTGGGCCATGGATGGGACCGG + Intergenic
977206582 4:94170194-94170216 CCTTGGGCGGTCGATGGGACCGG - Intergenic
977750909 4:100608776-100608798 CCTTGGGTGGTGGATGGGACTGG + Intronic
978443954 4:108763025-108763047 CCCGGGGCGTCGGAGGTCACCGG + Exonic
979224248 4:118265903-118265925 CCTTGGGCGGTCGATGGGACTGG - Intergenic
980698800 4:136395666-136395688 CCTTGGGCGGTGGATGGGACTGG - Intergenic
981136254 4:141213896-141213918 CCTTGGGCGGTGGATGGGACTGG - Intergenic
984275682 4:177607119-177607141 CCTTGGGCGGTTGATGGGACTGG + Intergenic
984662305 4:182386899-182386921 CCTTGGGCGGTCGATGGGACTGG - Intronic
984879662 4:184399365-184399387 CCTGTGGCCTCGGCTGTGACGGG - Intronic
985178030 4:187224145-187224167 CCTGGGGAGATGGTAGTGACTGG - Intergenic
985538633 5:477734-477756 CCTGGGACTTGGGATGTGTCTGG + Intronic
985590937 5:764708-764730 CCTTGGGTGGTGGATGGGACCGG - Intronic
985887001 5:2687558-2687580 TCTGGGGGGATGCATGTGACTGG - Intergenic
987990193 5:25200033-25200055 CCTTGGGCGGTCGATGGGACTGG + Intergenic
988086932 5:26485291-26485313 CCTTGGGCGGTCGATGGGACTGG + Intergenic
988684680 5:33515399-33515421 CCTTGGGCGGTCGATGGGACTGG + Intergenic
989003256 5:36782930-36782952 CCTTGGGTGGTGGATGGGACTGG - Intergenic
989168003 5:38449310-38449332 CCTAGGGCATTGGATGTCCCTGG + Intronic
989965881 5:50465363-50465385 CCTTGGGCGGTCGATGAGACTGG - Intergenic
990323118 5:54649029-54649051 CCTTGGGCGGCGGATGGGACCGG + Intergenic
992050418 5:72935593-72935615 CCTTGGGCGGTCGATGGGACTGG - Intergenic
992669448 5:79044169-79044191 CCTGGGACATTGGAGGTGACAGG - Intronic
993678550 5:90847528-90847550 CCTTGGGCGGTTGATGGGACTGG + Intronic
993770348 5:91917623-91917645 CCTTGGGTGGTGGATGGGACTGG - Intergenic
993803489 5:92374904-92374926 CCTTGGGCGGTGGATGGGAATGG + Intergenic
994620403 5:102155290-102155312 CCTTGGGCGGTGGATGGGACCGG - Intergenic
995529192 5:113075385-113075407 CCTTGGGCGGTCGATGGGACTGG - Intronic
995679815 5:114704299-114704321 CCTTGGGCGGTGGATGGGACTGG + Intergenic
996478644 5:123949200-123949222 CCTTGGGCTTTGGATGGGACCGG + Intergenic
996575836 5:124976129-124976151 CCTTGGGCGGTTGATGGGACCGG + Intergenic
996595762 5:125200847-125200869 ACTGGGGCGTTGGACGGGACTGG + Intergenic
999348596 5:150845776-150845798 CCTTGGGCAGTGGATGGGACTGG - Intergenic
1000329129 5:160193907-160193929 CCTTGGGCGGTCGATGGGACTGG + Intronic
1000903506 5:166936271-166936293 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1002790688 6:435589-435611 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1003069730 6:2936168-2936190 CCTTGGGCGGTTGATGGGACCGG - Intergenic
1003581494 6:7344565-7344587 CCTTGGGTGGTGGATGGGACTGG - Intronic
1003836159 6:10074720-10074742 CCTTGGGCGGTCGATGGGACCGG + Intronic
1004200321 6:13541890-13541912 CCTTGAGCGGTGGATGGGACTGG - Intergenic
1004497719 6:16180731-16180753 CCTTGGGCGGTCGATGAGACCGG + Intergenic
1004499620 6:16198111-16198133 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1004865996 6:19854437-19854459 CCTTGGGTGGTGGATGGGACTGG + Intergenic
1005042217 6:21609910-21609932 CCTTGGGCGGTTGATGGGACTGG + Intergenic
1005751249 6:28885145-28885167 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1005766369 6:29015428-29015450 CCTTGGGCGGTGGATGGGACGGG - Intergenic
1005978175 6:30816308-30816330 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1006434071 6:34017185-34017207 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1006748843 6:36364242-36364264 CCTTGGGTGGTGGATGGGACTGG + Intronic
1007095343 6:39209418-39209440 ACTGGGGCGTGGGACGTGACTGG + Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007738781 6:43998406-43998428 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1008572470 6:52829194-52829216 CCTTGGGCAGTCGATGTGACTGG + Intergenic
1008631063 6:53363460-53363482 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1010269402 6:73903503-73903525 CCTTGGGCAGTGGATGGGACTGG - Intergenic
1010617441 6:78030152-78030174 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1011601643 6:89065263-89065285 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1012189285 6:96260956-96260978 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1012760445 6:103294414-103294436 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1014240801 6:119015674-119015696 CCTTGGGCGGTCGATGGGACTGG - Intronic
1014487435 6:122016752-122016774 CCTGGTGGGTGGGAGGTGACTGG - Intergenic
1014718617 6:124892323-124892345 CCTTGGGCGGTTGATGGGACTGG - Intergenic
1015572194 6:134633554-134633576 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1015600405 6:134905080-134905102 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1016104674 6:140148131-140148153 CATTGGGCGGTGGATGGGACCGG + Intergenic
1016172886 6:141041634-141041656 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1018545724 6:164933647-164933669 CCTTGGGTGGTGGATGGGACTGG - Intergenic
1019104811 6:169659669-169659691 CCTGGGGCCTTGTATGTGTGAGG - Intronic
1019518101 7:1448407-1448429 CCTGGGGCTTTGCATGGGGCCGG + Intronic
1022538512 7:31113827-31113849 CCTGGAGCTCTGGATGTCACTGG + Intergenic
1023993994 7:45147414-45147436 GCTGGGGGGTTGGAGGTGATTGG + Intergenic
1024335579 7:48202924-48202946 CCTTGGGCGGTCGATGGGACTGG + Intronic
1026098285 7:67364548-67364570 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1026596503 7:71738090-71738112 CCTTGGGCGGTAGATGGGACTGG + Intergenic
1026853252 7:73737735-73737757 CCTGGGGAGTGGGGTGAGACGGG + Exonic
1027579657 7:79977614-79977636 CCTTGGGCGGTTGATGGGACTGG + Intergenic
1028392731 7:90334763-90334785 CCTTGGGCGGTTGATGGGACTGG - Intergenic
1028857220 7:95605613-95605635 CCTTGGGCGGTCGATGGGACCGG - Intergenic
1029381630 7:100219278-100219300 CTTGGTGCGTTGGAAGTGAAAGG + Exonic
1029401791 7:100351726-100351748 CCTGGTGCATTGGAGGTGAAAGG + Intronic
1029407157 7:100382082-100382104 CCTTGGGCGGTCGATGGGACCGG - Intronic
1030772165 7:113488145-113488167 CCTTGGGCGGTTGATGGGACTGG + Intergenic
1030980636 7:116181993-116182015 CCTTGGGCGGTTGATGGGACCGG + Intergenic
1032437176 7:131909675-131909697 CCTTGGGCGGTCGATGGGACCGG - Intergenic
1033664046 7:143424408-143424430 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1034396180 7:150826541-150826563 GCTGGGGCATTGGGTGTGACTGG + Intronic
1035580573 8:737364-737386 CCGGGGGCGACGGGTGTGACCGG + Intronic
1035999293 8:4583177-4583199 CCTTGGGTGGTGGATGGGACTGG - Intronic
1036123772 8:6045071-6045093 CCTTGGGCGGTTGATGTGACTGG + Intergenic
1037483637 8:19327612-19327634 CCTGGGGTGTTGGAAGAGGCGGG - Intronic
1037894359 8:22641912-22641934 CCTGGGGAGTGGGAGGGGACTGG + Intronic
1040806783 8:51404834-51404856 CCTTGGGCGGTCGATGGGACTGG + Intronic
1041034605 8:53775911-53775933 CCTTGGGCGGTCGATGGGACTGG + Intronic
1041588438 8:59547469-59547491 CCTTGGGCGGTTGATGGGACGGG - Intergenic
1041623603 8:60000211-60000233 CCTTGGGCGGTTGATGGGACCGG - Intergenic
1043352433 8:79377214-79377236 CCTTGGGCAGTTGATGTGACTGG + Intergenic
1043687107 8:83100694-83100716 CATGGGGCTCTGGGTGTGACTGG - Intergenic
1043857212 8:85276375-85276397 CCTTGGGTGGTCGATGTGACTGG - Intronic
1044459595 8:92429239-92429261 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1044963972 8:97557265-97557287 CCTTGGGCGGTTGATGGGACCGG - Intergenic
1045305994 8:100957195-100957217 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1045407323 8:101879992-101880014 CCTTGGGCGGTGGATGGGACTGG + Intronic
1047124815 8:121948429-121948451 CCTTGGGCAGTGGATGGGACCGG - Intergenic
1048312822 8:133339002-133339024 CCTGGGGCCTTGGAGGAGAAGGG - Intergenic
1048808495 8:138263295-138263317 CCTGGAGGGTTGGCTGTGTCCGG - Intronic
1049157744 8:141076990-141077012 CCTTGGGCAGTGGATGGGACTGG - Intergenic
1049520297 8:143084950-143084972 CCTGGGACATTGAATGTGTCAGG - Intergenic
1049520306 8:143084999-143085021 CCTGAGACGTTGAATGTGTCAGG - Intergenic
1050249998 9:3734116-3734138 CCTTGGGCGGTCGATGGGACTGG - Intergenic
1051449350 9:17178423-17178445 CCTTGGGCGGTAGATGGGACTGG + Intronic
1052901700 9:33799080-33799102 CCTGGGGCCATGGCTGTGCCTGG + Exonic
1053275703 9:36781706-36781728 CCTGGTGTGTTGGAGGTCACCGG - Intergenic
1055557529 9:77490395-77490417 CCTTGGGCGGTGGATGGGACTGG + Intronic
1056084065 9:83127694-83127716 CCTGGGTCCTTGGGTGGGACAGG + Intergenic
1056216334 9:84408830-84408852 CCTTGGGCGGTAGATGGGACTGG - Intergenic
1058902663 9:109455960-109455982 CCTGGGGACTTGGATGAGGCAGG + Intronic
1059891402 9:118809270-118809292 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1060463702 9:123883291-123883313 CCTGGTGCCTGGGAAGTGACTGG + Intronic
1185730945 X:2461248-2461270 CCTGGGGTGTTCGAGGTCACCGG - Intronic
1185733884 X:2482792-2482814 CCTGGGGTGTTCGAGGTCACCGG - Intronic
1186282042 X:8003328-8003350 CCTTGGGCGGTTGATGGGACTGG + Intergenic
1186293261 X:8121958-8121980 CCTTGGGCGGTTGATGGGACTGG - Intergenic
1187557521 X:20366861-20366883 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1188881888 X:35499628-35499650 CCTTGGGCAGTGGATGGGACCGG - Intergenic
1191053860 X:56222615-56222637 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1193803986 X:85972370-85972392 CCTTGGGCGGTTGATGGGACTGG + Intronic
1194197636 X:90914955-90914977 CCTTGGGCGGTTGATGAGACAGG + Intergenic
1194890437 X:99372083-99372105 CCTTGGGCGGTCGATGGGACCGG + Intergenic
1195460222 X:105115761-105115783 CCTTGGGCGGTTGATGGGACTGG + Intronic
1196827217 X:119750833-119750855 CCTTGGGCGGTCGATGGGACTGG + Intergenic
1196860810 X:120025780-120025802 CCTTGGGCGGTGGATGGGACTGG + Intergenic
1197707960 X:129647590-129647612 TTTGGGGCGTTAGATGAGACAGG + Exonic
1198376412 X:136044545-136044567 CTTGGGGCGCTGGATGTGGCCGG - Exonic
1199831230 X:151551198-151551220 CCTTGGGGGGTGGATGGGACTGG + Intergenic
1200165515 X:154032638-154032660 CCTGGGGCCTTGCATGTGGTGGG - Intronic