ID: 1152631328

View in Genome Browser
Species Human (GRCh38)
Location 17:81411855-81411877
Sequence AAGAGTGACCAGGGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152631328_1152631337 19 Left 1152631328 17:81411855-81411877 CCCTCCACACCCTGGTCACTCTT 0: 1
1: 1
2: 1
3: 29
4: 299
Right 1152631337 17:81411897-81411919 CCATCGTATCCCTGCATCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1152631328_1152631338 20 Left 1152631328 17:81411855-81411877 CCCTCCACACCCTGGTCACTCTT 0: 1
1: 1
2: 1
3: 29
4: 299
Right 1152631338 17:81411898-81411920 CATCGTATCCCTGCATCCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152631328 Original CRISPR AAGAGTGACCAGGGTGTGGA GGG (reversed) Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
902269087 1:15290198-15290220 CAGAGTGACCAGGTTGTGAGTGG - Intronic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
903363207 1:22790121-22790143 AAGAGTGAGTAGGATTTGGATGG + Intronic
903662865 1:24989360-24989382 AACAGAGGCCAGGGTGTGCAGGG + Intergenic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
905059843 1:35130557-35130579 CAGTGTTAACAGGGTGTGGAAGG - Intergenic
905541670 1:38764958-38764980 AGGAGAGACCAGGGGGTGGGGGG + Intergenic
905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG + Intergenic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
910602000 1:89042636-89042658 AAGAGTGAGCTGAGTGGGGAGGG + Intergenic
911872873 1:103121338-103121360 AAGAGTGCCCAAAGTCTGGAAGG + Intergenic
912178838 1:107193189-107193211 AAGAGTGAAGAAGTTGTGGAAGG - Intronic
915865017 1:159490349-159490371 AAGAGAGACAAGGGTGGGGAAGG - Intergenic
918041760 1:180917947-180917969 TAGAGGGACCATGGTGAGGAGGG - Intronic
918380627 1:183951010-183951032 AAGATTGTCGAGGCTGTGGATGG - Exonic
919448951 1:197746962-197746984 AGGATAGACCAGGCTGTGGAGGG - Intronic
919823015 1:201484679-201484701 AGGAGTGGGCAGGGTGTGGTGGG + Exonic
919901278 1:202046029-202046051 AACAGGGACCAGGGAGTGGTGGG + Intergenic
919910306 1:202106915-202106937 AAGAGAGGACAGGGTGTGGAAGG + Intergenic
920343010 1:205287444-205287466 AAGAGGGAACAGGGTGGGGAGGG - Intergenic
920777988 1:208959078-208959100 TAGAGTGGCCAGGATGTGGGAGG - Intergenic
921293542 1:213681017-213681039 CAGACAGACCAGGATGTGGATGG + Intergenic
921908057 1:220516176-220516198 AAGAATGAGCATGCTGTGGATGG - Intergenic
922449703 1:225726795-225726817 AGGAGTGACCAGTGTGGGGTAGG + Intergenic
922914025 1:229240929-229240951 AAGAGTGACTGGGGGCTGGAGGG - Intergenic
1062890692 10:1057241-1057263 CAGAGGGACCAGGGTGCGGGAGG + Intronic
1063249753 10:4261391-4261413 AAGAGTGAAGAGGATGGGGATGG + Intergenic
1064005654 10:11696920-11696942 GGGAGTGACCTGTGTGTGGATGG - Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067800539 10:49355389-49355411 AAAGGTGGCCAGGGTGTGGTGGG - Intergenic
1068616699 10:59126405-59126427 AAGAGAGACCAGGGACTGGGAGG - Intergenic
1069286458 10:66721180-66721202 AAGAGACCCAAGGGTGTGGAAGG + Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072198588 10:93138443-93138465 AAAAGTTGCCAGGCTGTGGAAGG + Intergenic
1072596329 10:96875708-96875730 AAGAGTTAGCTGGGTGTGGTGGG + Intronic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073339607 10:102735091-102735113 AGGAGTGACCAGGATGGGGAGGG - Intronic
1073457681 10:103647408-103647430 TGGAGAGACCAGGGTGTGGAGGG + Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078504144 11:11917631-11917653 AAGAGTAAACAGGGTGGGGGTGG + Intronic
1081389067 11:42507590-42507612 AAGAGGGTCTAGTGTGTGGAGGG + Intergenic
1082219838 11:49621370-49621392 AAGAGAGAGCAGGGTGAGGGGGG - Intergenic
1083378309 11:62244010-62244032 GAGAGTGTCGTGGGTGTGGAGGG - Intronic
1083764655 11:64836094-64836116 GTGAGTGACCAGGGTGGGTAGGG - Intronic
1084461850 11:69300601-69300623 AGGAGGGAGTAGGGTGTGGAAGG + Intronic
1084692208 11:70734051-70734073 AAGAGTCACCAGGGGCTGGGAGG + Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086629792 11:89003407-89003429 AAGAGAGAGCAGGGTGAGGGGGG + Intronic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1087619763 11:100528256-100528278 AAGAGTGACATCGGAGTGGAGGG + Intergenic
1089294246 11:117458460-117458482 AAGAATGCCCATGGTGTGGGAGG + Intronic
1089563871 11:119360206-119360228 AAGAGTGCCCAGGGTCTGGCTGG - Exonic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091282543 11:134390253-134390275 AGCAGTGGCCTGGGTGTGGAGGG - Exonic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1091450006 12:566483-566505 AATAGTGAATAGGGTGAGGAAGG - Intronic
1092148113 12:6228779-6228801 AAAAGTAGCCAGGGTGTGGCTGG - Intronic
1096638872 12:52978473-52978495 AAGAGTGAACTGGGTGAGGAAGG - Intergenic
1097247474 12:57614475-57614497 AAGAGAGAGCAGGGTGGGCAAGG - Intronic
1098247865 12:68538968-68538990 AGGAGGGGCCAGGGTGTGGGCGG - Intergenic
1098284537 12:68894114-68894136 GAGAGTGACTAGGGTGTATATGG - Intronic
1098408921 12:70158226-70158248 AAGAGAAACTAGGGTGAGGAAGG - Intergenic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1098738715 12:74142593-74142615 AAGAGTGTGAAGGATGTGGAAGG - Intergenic
1099940521 12:89182709-89182731 GAGAGTGACCAGGTTGGAGAAGG - Intergenic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1102432788 12:112896838-112896860 AAGAGAGATCAGGGTGCGGTGGG - Exonic
1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG + Intronic
1104081708 12:125435359-125435381 AAGAGAGACTGGGGTGCGGAAGG + Intronic
1104801620 12:131558618-131558640 AGGAAAGACCAGGGAGTGGAGGG - Intergenic
1105274721 13:18909073-18909095 AAAAGTTACCTGGGTGTGGTGGG - Intergenic
1107915494 13:45145836-45145858 AAGCCTGAACAGGGTGAGGAGGG - Intronic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108805830 13:54155140-54155162 AAAAGTGACCTGGGTTTAGAAGG - Intergenic
1109206950 13:59493012-59493034 AAGTGTGACCTGGGTTAGGATGG - Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1112226173 13:97542736-97542758 TGCAGTGACCAGGATGTGGACGG - Intergenic
1113203336 13:107890183-107890205 AAGAGTGTGCTGTGTGTGGAAGG + Intergenic
1113496043 13:110730133-110730155 CACAGTGACCAGGGTATGAATGG + Intergenic
1113678747 13:112227123-112227145 AGGAGTGAGGAGGGTTTGGATGG - Intergenic
1114189471 14:20429760-20429782 AGGAGTGGGCAGGGTGTGGCAGG - Intronic
1117433798 14:55697407-55697429 AGAAGTGACCAGGGGGTGAATGG - Intronic
1118992310 14:70808631-70808653 ACGATTGACCTGGGTGTGGGTGG - Intronic
1119547585 14:75483432-75483454 CAAAGTGTTCAGGGTGTGGATGG - Intergenic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1121597848 14:95179515-95179537 AGGAGTGCCCAGGCTGCGGATGG + Intergenic
1121780178 14:96617248-96617270 AAATATGACCAGGGTGGGGAGGG + Intergenic
1122011186 14:98750233-98750255 TAGAGAGAGCAGGGTCTGGATGG + Intergenic
1122130487 14:99602354-99602376 ATCCGTGACCAGGGTGTGGGTGG - Intronic
1123630261 15:22256268-22256290 AAATGTGCCCAAGGTGTGGAGGG + Intergenic
1124146240 15:27127992-27128014 AAATGTGACCTGGGTATGGAAGG + Intronic
1126097925 15:45102266-45102288 AGGGGTGTCCAGGGTGTGCATGG + Intronic
1126412943 15:48390697-48390719 GAGAGGGACGAGGGTGTGGATGG - Intergenic
1129366666 15:75059981-75060003 AAGAGAGAGAAGGCTGTGGAAGG + Intronic
1130097558 15:80867371-80867393 AAGAGAGACCAGGCTTTGGAGGG + Intronic
1133245632 16:4447104-4447126 ATGAGTGACCAGCATGTGGGGGG + Intronic
1133931504 16:10236368-10236390 AAGAGAAACCAGAGTGTGAAAGG + Intergenic
1134083404 16:11340069-11340091 AAGGGTTCCCAGGGTGGGGATGG + Intronic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1138909498 16:61379302-61379324 AAGAGTTTCAAGGGTGTAGAGGG - Intergenic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1139352823 16:66348030-66348052 TAGAGTGACAAGAGTGTGGGTGG - Intergenic
1139512490 16:67435544-67435566 CAGAATCACCAGGGTCTGGATGG - Intronic
1139754168 16:69129682-69129704 AAGAGGGGCCAGATTGTGGAGGG - Intronic
1139842536 16:69893076-69893098 AAGAGTGACCAGCATGGGGGAGG - Intronic
1140546961 16:75819965-75819987 AAGAGTGATCAGGGATTGCATGG - Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1141574496 16:84955382-84955404 AAGAGGGCACAGGGTGTGGGGGG - Intergenic
1141972825 16:87494375-87494397 AAATGTGCCCAAGGTGTGGAGGG - Intergenic
1142265929 16:89063966-89063988 GTGGGTGACCAGGGTGGGGATGG - Intergenic
1143358313 17:6347477-6347499 AAGAGAGGCCAGGGTATGGAAGG - Intergenic
1143385610 17:6528412-6528434 AAGAGAGAACAGGGAGGGGAGGG - Intronic
1143989752 17:10946798-10946820 AAGAATGAGAAGGGTGTGTATGG - Intergenic
1144050585 17:11494354-11494376 AACAGAGACCAGGGAATGGAGGG - Intronic
1144562128 17:16329515-16329537 GAGAGTGACCAGGCTGGGGTGGG + Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144670991 17:17132500-17132522 GAGAGGGAGCAGGGTGGGGATGG + Intronic
1145762477 17:27433710-27433732 GACAGTGGCCAGGGTGAGGATGG - Intergenic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1149392129 17:56202583-56202605 AATGGTGAAAAGGGTGTGGAGGG - Intronic
1150429665 17:65105102-65105124 AATCGTGACCATGGGGTGGATGG + Intergenic
1150636686 17:66918194-66918216 AAGAATGACCAGGCTCTGGGAGG - Intergenic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1152377987 17:79928515-79928537 AAGAGGGAGCAGGCTGGGGAAGG - Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1154313915 18:13288773-13288795 CAGAGTGACCACGGTCTGCAGGG - Intronic
1155083210 18:22430629-22430651 AAGAGAGACCAGGCTGTGGCAGG - Intergenic
1156887437 18:42151767-42151789 AAGTGTGCCCAGGGTGTTGCTGG - Intergenic
1159930832 18:74311658-74311680 AAGGGTGAGCCAGGTGTGGAGGG + Intergenic
1160764181 19:799823-799845 AAGAGCCACCTGGCTGTGGAGGG + Intronic
1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG + Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1164457516 19:28421049-28421071 AAGAGGGACGAGGCTGTGGCTGG - Intergenic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1166037790 19:40181760-40181782 AAGAGTGAACAGGGTTTAGCAGG + Intergenic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1166379962 19:42350693-42350715 AAGAGGAAGCAGGGTGTCGAGGG - Intronic
1166462100 19:42996613-42996635 AAGACTGACCAGGGAGTGTTGGG - Intronic
1166501887 19:43347740-43347762 AAGACTGACCAGGGAGTGTTGGG - Intergenic
1166508229 19:43385711-43385733 AAGACTGACCAGGGAGTGTTGGG + Intergenic
1167720022 19:51172886-51172908 AAGAATGACCAGGGTCAGGATGG - Intergenic
1167749467 19:51371129-51371151 AAGACTGACCATATTGTGGAGGG - Intergenic
1168327393 19:55545239-55545261 GAGAGAGACCAGGGTGGGCAGGG - Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927043354 2:19252388-19252410 AAGCGTTACCAGAATGTGGATGG - Intergenic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
930173410 2:48275474-48275496 AAGACTTACCAGGGTCTGGCTGG - Intergenic
930408687 2:50996066-50996088 AAGAGTGAGCAGGTTCTGCAAGG + Intronic
932591066 2:73068070-73068092 AAGAGGGTGGAGGGTGTGGAGGG - Intronic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
934773256 2:96921394-96921416 TAGAGTGCCCTGGGTGGGGATGG - Intronic
935111777 2:100100855-100100877 AAGGAAGACCAGGGAGTGGAGGG + Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936123188 2:109764313-109764335 AAGGAAGACCAGGGAGTGGAGGG - Intergenic
936221494 2:110607156-110607178 AAGGAAGACCAGGGAGTGGAGGG + Intergenic
937062639 2:118991854-118991876 AAGGGAGACCAGGGAGTGAAAGG + Exonic
938887428 2:135666205-135666227 AAGAGTAACTAGGGTGTAAAAGG + Intronic
941327478 2:164134799-164134821 AAGAGGGAGCAGGGTAAGGAAGG + Intergenic
943189490 2:184657844-184657866 AGGAGTTAACAGGCTGTGGAAGG + Intronic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946563761 2:220940986-220941008 TAGAGTGACAAGGGTGGGGCAGG + Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
948468070 2:238161657-238161679 CAGAGTGACAAGGGTGTCAATGG + Exonic
948488417 2:238295891-238295913 AAGAGTTCCCCGGGTGTGGGTGG - Intergenic
948637560 2:239349177-239349199 AAGAGTGAGCCGGGTGGGCAGGG + Intronic
948641457 2:239378277-239378299 AGCGGTGACCAGGGTGGGGAGGG + Intronic
1170885136 20:20334082-20334104 AAGGGAGCCCAGGGTGTGGGAGG + Intronic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1172595501 20:36148520-36148542 AGGTGAGACCAGGCTGTGGAAGG + Intronic
1172851718 20:37971156-37971178 AAGGGTAACTAGGATGTGGAAGG + Intergenic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174402924 20:50285539-50285561 AAGTGAGGCCAGGGTGAGGAAGG - Intergenic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175279590 20:57794168-57794190 GAGAGTGAGGAGGGTGGGGATGG + Intergenic
1175735781 20:61386097-61386119 AGTAGTGACAAGGGTGTGTAGGG + Intronic
1177834572 21:26173940-26173962 GAGAATGGCCAAGGTGTGGAAGG - Intergenic
1178369654 21:32017009-32017031 ATGAGTGAGAAGGCTGTGGATGG - Intronic
1181403471 22:22665798-22665820 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1181408474 22:22701782-22701804 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1183452174 22:37902722-37902744 ATGTGTGAACAAGGTGTGGAAGG + Intergenic
1183735610 22:39643288-39643310 GAGACTGAGCAGGGTTTGGAGGG + Intronic
1183951114 22:41353669-41353691 GAGGCTGACCAGGGTGTGGCAGG + Intronic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
1185272840 22:49936566-49936588 AAGTGTGACCTGGGTGGGGCGGG - Intergenic
951562923 3:23986322-23986344 AATAGTTACCAGGGTTTGGGAGG + Intergenic
953106280 3:39883241-39883263 AAGAGTGAACTGGATGTGGAAGG + Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
954872839 3:53780787-53780809 AGGAGTGACCAGGAGGTGGGGGG + Intronic
955286657 3:57647890-57647912 GAGAGTGAGCAGGGTAAGGAGGG + Intronic
955286809 3:57649757-57649779 GAGAGTGAGCAGGGTAAGGAGGG - Intronic
955587658 3:60499083-60499105 ATGAGTGACCAAGGAGTTGAAGG + Intronic
959578781 3:107963167-107963189 AAGAGTGGCCAGGCTGGGGGAGG - Intergenic
961168412 3:124779379-124779401 ACGTGTGACCTGGGTGTGGGAGG + Intronic
961202869 3:125058039-125058061 AAGATTGATCAAGGTGTAGATGG + Intergenic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962143696 3:132817850-132817872 AAGAGTGACCAAGATGTCGGGGG + Intergenic
962302503 3:134254552-134254574 AAGAGAGACGAGGGTGTGTGTGG - Intergenic
962595250 3:136935625-136935647 AAGAGTGACCATAGTGAGAAGGG + Intronic
965259812 3:166467637-166467659 AAGAGTGGCCATGGTGTCAAGGG + Intergenic
965523442 3:169691791-169691813 ATGAGTGACTAGCTTGTGGAAGG - Intergenic
966340902 3:178924102-178924124 AACACTGACCAGGGGGGGGATGG - Intergenic
966889468 3:184396274-184396296 ACGAGTAACAAGGCTGTGGACGG + Intronic
968666630 4:1825939-1825961 AGGAGTGGCCAGGGTGGGGCTGG - Intronic
968914216 4:3490146-3490168 ATGAATGAGCAGGGTGGGGAAGG - Intronic
969522395 4:7686284-7686306 AAGAGTGACCATGGACTGCACGG - Intronic
969984427 4:11192733-11192755 ATGAGTGATAAGGGTGTGGGGGG - Intergenic
970423897 4:15929215-15929237 AAGACTGTCCAGGGAGTGTAAGG - Intergenic
971431354 4:26571346-26571368 AAGAGTAACCTAGTTGTGGAAGG - Intergenic
971479097 4:27098688-27098710 AAGAATGACAAGGATGAGGATGG - Intergenic
977568731 4:98608876-98608898 AAGAGTTTACAGGGTGTGGTGGG - Intronic
977923234 4:102669352-102669374 AGGAGTGACAAGGGGCTGGAGGG - Intronic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
981291360 4:143080207-143080229 AAGAGGGTCCTAGGTGTGGAAGG - Intergenic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
983300066 4:165913861-165913883 AAAAATGACCAGAGTGTGGGTGG + Intronic
983481820 4:168284211-168284233 AATAATGACCAAGGTGTGGGGGG - Intronic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
987609617 5:20185481-20185503 AAGAGTGACCAAGGTATGCCAGG - Intronic
991589143 5:68230891-68230913 AAGAGTGTGCTGGGTGTGCAAGG + Intronic
992918347 5:81483030-81483052 AATAGTGATCAGGGAGTGGCTGG + Intronic
994247368 5:97494767-97494789 AAGTGTGACCAAGGAGTGGTAGG + Intergenic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
995517438 5:112968099-112968121 AAGAGTGATCAGGCTGGGGATGG - Intergenic
996757229 5:126947773-126947795 AAGATTGGCCAGGGTGAGGTAGG - Intronic
998585032 5:143418619-143418641 AAGAGGGCACAGGGTGTGAAGGG + Intronic
999237558 5:150108142-150108164 AAGAGTGCACAGGGTATGGGAGG + Intronic
999247660 5:150163802-150163824 AAGCCTGATGAGGGTGTGGAAGG - Intergenic
999452237 5:151686993-151687015 AGGAGGGACCACGGGGTGGAGGG - Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001279949 5:170379527-170379549 AAGAATTGCCAGGGTGTGGCAGG + Intronic
1003975988 6:11345098-11345120 AAGAGGGACCGGGGTGAGGCAGG + Intronic
1005496869 6:26395424-26395446 GTGAGAGTCCAGGGTGTGGATGG - Intergenic
1005578355 6:27210874-27210896 AAGAGTGAACAGGCTGGGCACGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006992936 6:38230870-38230892 GAGAGTGACTAGGCTGTGGTAGG - Intronic
1007480384 6:42145799-42145821 AAGGTTGGCCAAGGTGTGGAAGG + Intergenic
1007689143 6:43687500-43687522 ATAAGGCACCAGGGTGTGGAAGG + Intronic
1007769314 6:44180414-44180436 AAGAGTTACCAGGGGGAGGGAGG - Intronic
1008878852 6:56360155-56360177 AAAAGTGACAGGGGAGTGGAGGG + Intronic
1014155588 6:118105502-118105524 AAGAATGACCACGGTGTGAGTGG - Intronic
1014947301 6:127514619-127514641 AAGAGTGCAGAGTGTGTGGAGGG - Intronic
1015082209 6:129240550-129240572 AGGTGTGACCAGGATGTTGATGG - Intronic
1015428546 6:133102206-133102228 AAGAGTGACCAGGGGTTGTCAGG + Intergenic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1018182121 6:161233057-161233079 GTGTGTGACCAGGGTGTGGTGGG - Intronic
1019517421 7:1446182-1446204 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517478 7:1446326-1446348 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517517 7:1446432-1446454 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022729673 7:33010536-33010558 GAGAGGGAACAGGGTGTGGAAGG - Intergenic
1023551060 7:41370057-41370079 AGGAGGGACCAGGGGGTGGGGGG + Intergenic
1024014953 7:45305230-45305252 GTGAGTGAGCAGGATGTGGAAGG + Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1024517511 7:50271952-50271974 AAGAGTGACGAGGGTGGAGGAGG + Intergenic
1024855571 7:53774565-53774587 AAGATGAACCAGGCTGTGGAGGG + Intergenic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1025806018 7:64835510-64835532 AAGAAGGACCAGGGTGGAGAGGG + Intergenic
1026914441 7:74111613-74111635 AAGAATGGCCAGGGTGGGGCCGG - Intronic
1029542892 7:101194926-101194948 AAGAGTGAGCAGGATTTAGATGG - Intergenic
1030437704 7:109545838-109545860 CAGAGTGACCATGCTGTGGCAGG - Intergenic
1031266977 7:119593307-119593329 AAGGGTGTCCAGTGTGTGGGAGG + Intergenic
1031992681 7:128208288-128208310 AGAAGTGTCCATGGTGTGGAAGG - Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1035129951 7:156642388-156642410 ATGAGTGACCGGGTTGTGGAGGG + Intronic
1035329033 7:158084627-158084649 ATGAGTGTCGTGGGTGTGGATGG - Intronic
1035329051 7:158084703-158084725 ATGAGTGTCGTGGGTGTGGATGG - Intronic
1035908203 8:3536750-3536772 AAAAGTGTCCATTGTGTGGAAGG + Intronic
1035929421 8:3764274-3764296 GAGAGACACCAGGGTTTGGACGG - Intronic
1036797492 8:11766806-11766828 AAGAATTAGCAGGGTGTGGTGGG + Intergenic
1038306908 8:26413245-26413267 AACAGTGCTCAGGGTGTGAACGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038317731 8:26501995-26502017 AAGAGTTACCAGACTGTGCAGGG - Intronic
1038433169 8:27515931-27515953 AAGTGTGACCAGGTTGGGGCAGG + Intronic
1047476602 8:125238135-125238157 AAGAGAGACCCGGGTTAGGAGGG - Intronic
1049250368 8:141585373-141585395 AAGAGGAGCCAAGGTGTGGATGG + Intergenic
1049658486 8:143809288-143809310 AAGAGAGTCCAGGGTGGGGGTGG + Intronic
1049978568 9:883069-883091 AAGAGTGAAAAGGGTGGGGTGGG - Intronic
1050342067 9:4650376-4650398 AAGGGTGAAAAGTGTGTGGATGG - Intronic
1050457402 9:5847074-5847096 AAGAATGCCCAGGGGATGGAGGG + Intergenic
1055048935 9:71960206-71960228 AGGAGGGACCAGGGAATGGAGGG + Intronic
1056340096 9:85620743-85620765 AAGAGACAACAGGGTGTGGTGGG + Intronic
1056680178 9:88710574-88710596 AAGGGAGTACAGGGTGTGGAGGG + Intergenic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1057966405 9:99508221-99508243 AAGAGAGACCAGAGTAGGGAAGG - Intergenic
1058879132 9:109271515-109271537 ACGAGTGATCAGAGTCTGGAAGG - Intronic
1058942532 9:109826729-109826751 AAGTGTGAATAGGGTGTGAATGG + Intronic
1060279404 9:122205941-122205963 AGCAGTGGCCAGGGTGGGGAAGG - Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1060869822 9:127030594-127030616 AAGAGTGAGCAGGAGCTGGAGGG + Intronic
1061374481 9:130215904-130215926 AAGAGGGAGCAGGATGTGGGAGG - Intronic
1203376931 Un_KI270442v1:384072-384094 AAGTGTGACCCCTGTGTGGATGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186983965 X:14990574-14990596 AATAGTTACCAGTGTGTAGATGG - Intergenic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1192913628 X:75632120-75632142 AAGCGTGACCAGGGACTGCATGG + Intergenic
1194678592 X:96824037-96824059 TAGAATGATCAGAGTGTGGAGGG - Intronic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1195942654 X:110178523-110178545 AAGACTGCCCAGGGTAGGGATGG - Intronic
1196433551 X:115653750-115653772 AAAACTGAGCAGGGTGTGGCCGG - Intergenic
1196704231 X:118703011-118703033 AAAAGAAAGCAGGGTGTGGAAGG + Intergenic
1198430094 X:136556729-136556751 AGGAGCAAGCAGGGTGTGGATGG - Exonic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic