ID: 1152631744

View in Genome Browser
Species Human (GRCh38)
Location 17:81413634-81413656
Sequence AAGCAGCCACAAGGCCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152631734_1152631744 13 Left 1152631734 17:81413598-81413620 CCAGACGTCCTGCCTTGGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1152631733_1152631744 14 Left 1152631733 17:81413597-81413619 CCCAGACGTCCTGCCTTGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1152631730_1152631744 19 Left 1152631730 17:81413592-81413614 CCGTTCCCAGACGTCCTGCCTTG 0: 1
1: 0
2: 1
3: 26
4: 195
Right 1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1152631735_1152631744 5 Left 1152631735 17:81413606-81413628 CCTGCCTTGGTGGAGTGAGCAGA 0: 1
1: 0
2: 2
3: 17
4: 225
Right 1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1152631736_1152631744 1 Left 1152631736 17:81413610-81413632 CCTTGGTGGAGTGAGCAGACCCC 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152631744 Original CRISPR AAGCAGCCACAAGGCCGCGG GGG Intronic
901024328 1:6271030-6271052 AGGCAGCCACTAGGCTGCAGGGG - Intronic
901852446 1:12024314-12024336 AACCAGCCAGAAGGCAGCTGAGG - Intronic
902210291 1:14899991-14900013 AAGCAGCCACAGGGCCGGAACGG - Intronic
911315582 1:96352974-96352996 AAGCAGCCACCAGGCTCCAGAGG + Intergenic
915636247 1:157189235-157189257 AAGCAGTCACAAGGCCCCCGTGG + Intergenic
920971913 1:210750028-210750050 AAGCAGCCAGCTGGACGCGGCGG - Intronic
921110868 1:212035505-212035527 AACCAGCAAGAAGGCGGCGGGGG - Exonic
922992487 1:229926279-229926301 AAGCAGCCACAAGGTCTCTCTGG - Intergenic
1062794064 10:329529-329551 AAGAAGCCACAAGGCGGGGTTGG + Exonic
1065877250 10:30008081-30008103 GAGCAGCCACAAGGCCAAGAGGG - Intergenic
1070696973 10:78570775-78570797 AGGCAGGCACCAGGCCCCGGAGG - Intergenic
1076666337 10:132095083-132095105 AAGCAGACTCAAGGCTGCTGTGG - Intergenic
1076693045 10:132233470-132233492 AAGCAGCCACTAGGCATCGGGGG - Intronic
1077102094 11:827006-827028 GAGCAGGGACAAGGCTGCGGGGG - Intronic
1077579245 11:3406329-3406351 AAGCAGCCACATGGCCTGGCTGG - Intergenic
1079064343 11:17276605-17276627 GAGCAGGGACAAGGCCGCGCCGG - Intronic
1080669072 11:34359122-34359144 GAGTAGCCACAGGGCAGCGGCGG - Intergenic
1084068930 11:66721320-66721342 AAGAAGACAGAAGGCCCCGGTGG - Intronic
1084236269 11:67789873-67789895 AAGCAGCCACACGGCCTGGCTGG - Intergenic
1084736502 11:71108800-71108822 CAGCAGCCACAAGCCCGTGCCGG + Intronic
1089736882 11:120555771-120555793 AAGAAGCCCCAAGGCCTCTGAGG - Intronic
1091146737 11:133286615-133286637 AATGAGCAACAAGGCCGCCGAGG - Intronic
1091391954 12:131200-131222 AAGCAGCGGCAGGGGCGCGGGGG - Intronic
1092407174 12:8229280-8229302 AAGCAGCCACACGGCCTGGGTGG - Intergenic
1095097205 12:38155084-38155106 AAGCAGCAAGAAGGCCTCCGGGG + Intergenic
1095098318 12:38159489-38159511 AAGCAGCAAGAAAGCCCCGGGGG + Intergenic
1113751979 13:112782873-112782895 AGGCAGCCACCAGGCCAGGGAGG - Intronic
1121307861 14:92918126-92918148 AAGGAGCAAAAAGGCCGAGGTGG - Intergenic
1121585336 14:95059445-95059467 AAGGAGCTACAAGGACGGGGAGG - Intergenic
1123068541 14:105629976-105629998 AAGCAGCCACCAGGGCCCAGTGG - Intergenic
1123072540 14:105648775-105648797 AAGCAGCCACCAGGGCCCAGTGG - Intergenic
1123098126 14:105776002-105776024 AAGCAGCCACCAGGGCCCAGTGG - Intergenic
1126063885 15:44810356-44810378 AGGCAGCTACACGGCGGCGGGGG - Intergenic
1133138440 16:3728331-3728353 CAGCAGCCTCAAGGACCCGGAGG - Exonic
1136421781 16:30138930-30138952 AATTAGCCAGAAGGCCGAGGCGG - Intergenic
1140661541 16:77194510-77194532 AACCAGCCAGCAGGCGGCGGAGG - Exonic
1141660520 16:85438917-85438939 AGGCAGGCAGGAGGCCGCGGGGG - Intergenic
1142022546 16:87792939-87792961 ATGCAGCCACAAGGCCAGGCTGG + Intergenic
1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG + Intronic
1143771460 17:9171669-9171691 AAACAGCCACAAGGAAGCTGAGG + Intronic
1144006118 17:11101351-11101373 AAGCAGCCAGAAGGCCAGTGTGG + Intergenic
1148335205 17:46836226-46836248 AAGCAGCCAAAAGAGTGCGGAGG + Intronic
1150378208 17:64699884-64699906 AAGCAACCAGAAGGCCTGGGTGG + Intergenic
1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG + Intronic
1152742656 17:82025111-82025133 GATCAGTCACAAGGGCGCGGAGG + Exonic
1154270324 18:12912544-12912566 GAGCAGCCACTGGGCCGCGCGGG - Intronic
1161159792 19:2755454-2755476 GAGCAGGCACAGGGCCGGGGTGG + Exonic
1165735728 19:38174257-38174279 AAGCAGCCACATTGCCCCTGTGG - Intronic
1166641863 19:44500431-44500453 CAGCATCCGCAAGGCCGCTGGGG + Exonic
1166900539 19:46058390-46058412 AAGCAGCCACAAAGACACAGAGG - Intronic
1167561856 19:50230869-50230891 CAGGAGCCACCAGGCGGCGGGGG - Intronic
927708931 2:25313449-25313471 CGGCAGACACGAGGCCGCGGGGG - Intronic
946427465 2:219606870-219606892 CCGCAGGCACAAGGCAGCGGAGG - Intronic
948537323 2:238655837-238655859 AAGGAGACACAAGGCCCCAGAGG + Intergenic
1172568937 20:35954060-35954082 AGGCAGCTCCAGGGCCGCGGAGG + Exonic
1174088458 20:48027282-48027304 AAGAATCCACAAGGCCCTGGAGG + Intergenic
1181026707 22:20131400-20131422 AAACAGCCACGACGCCGCTGCGG + Intronic
1183034517 22:35131055-35131077 AGGCAGCCACAAGGGAGCGTGGG + Intergenic
1183083692 22:35473613-35473635 AAGCAGCTACTAGGCTGCAGAGG + Intergenic
1183604343 22:38859997-38860019 AAGCACCCACAGGGCAGGGGAGG - Intergenic
1184184778 22:42857256-42857278 CAGGAGCGACGAGGCCGCGGGGG + Exonic
1184732608 22:46378940-46378962 GAGCAGCCTCACTGCCGCGGAGG + Intronic
953198273 3:40754285-40754307 AAGCATCTACAAGGCTGGGGAGG - Intergenic
954129615 3:48553674-48553696 GAGCAGCCACAAGTCCCTGGAGG + Intronic
954360969 3:50122686-50122708 CAGCAGCCACAAGGGGACGGAGG + Intergenic
957052223 3:75419656-75419678 AAGCAGCCACACGGCCTGGCTGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
961418945 3:126784462-126784484 AAGCAGCAGCAAGGCAGTGGGGG - Intronic
961885834 3:130095879-130095901 AAGCAGCCACACGGCCTGGCTGG - Intronic
962244827 3:133783953-133783975 AGGCGGCCCCAACGCCGCGGAGG + Intergenic
962741913 3:138368068-138368090 CAGCAGCCACTTGGCCGTGGGGG - Intronic
968232211 3:197010808-197010830 AAGAAGCCACTGGGCCGGGGTGG + Intronic
968566303 4:1315471-1315493 TAGCAGCGACCAGCCCGCGGCGG + Exonic
968873265 4:3252217-3252239 AAGAAGCCACAAGGTGGGGGTGG - Intronic
969758964 4:9168762-9168784 AAGCAGCCACACGGCCTGGCTGG + Intergenic
969818934 4:9706236-9706258 AAGCAGCCACACGGCCTGGCTGG + Intergenic
970483220 4:16498706-16498728 AAGCAGCCACAAGCCAGCCCAGG - Intergenic
975517168 4:75259817-75259839 AAGCAGCAAAAAGGCCCTGGGGG + Intergenic
982384167 4:154781761-154781783 AAGCGGCCGGAAGGCAGCGGGGG - Intronic
985624253 5:976926-976948 AACCACCCACCAGGCCCCGGAGG - Intergenic
985644425 5:1078300-1078322 TGGCAGCCCCAAGGCCCCGGGGG - Intronic
986317423 5:6599905-6599927 GAGCAGGCCCAAGGCAGCGGGGG - Exonic
998878770 5:146626605-146626627 AAGCAGCCACAAGCACCTGGGGG - Intronic
1002026251 5:176397800-176397822 AGGCAGCCACAGGGCCGCACCGG + Intronic
1002617952 5:180467232-180467254 CAGAAGCCAGAAGGCCGGGGCGG + Intergenic
1004305972 6:14502270-14502292 AAGCAGTCACGAGGCAGAGGAGG - Intergenic
1008629398 6:53348846-53348868 GAGCAGCAGCAAGGCGGCGGCGG + Exonic
1016996177 6:149963811-149963833 ACGCCGCCACCAAGCCGCGGGGG + Intergenic
1018783513 6:167090382-167090404 AAGCAGCCACAGAGGCGAGGTGG - Intergenic
1020319290 7:6928350-6928372 AAGCAGCCACACGGCCTGGCTGG - Intergenic
1025561670 7:62379474-62379496 CAGCAGGCAAAAAGCCGCGGCGG - Intergenic
1027202420 7:76072306-76072328 AGGCAGCCACCGGGCCGTGGTGG + Intergenic
1027428074 7:78082066-78082088 AAGTAACCACAAGGCGGCAGTGG - Intronic
1031461364 7:122053251-122053273 AAGCAGGCACAAGTCCCAGGAGG + Intronic
1032452654 7:132046508-132046530 CAGCATCCCCAAGGCCGCTGGGG + Intergenic
1036847544 8:12180197-12180219 AAGCAGCCACACGGCCTGGCTGG - Intergenic
1036868912 8:12422512-12422534 AAGCAGCCACACGGCCTGGCTGG - Intergenic
1040277899 8:46023289-46023311 AAGCAGCAAGAAGGCCCCCGGGG - Intergenic
1040278605 8:46026337-46026359 AAGCAGCAAGAAGGCCCCTGGGG - Intergenic
1040601617 8:48890403-48890425 CAGCAGCCACATGGCAGAGGAGG + Intergenic
1044734890 8:95269086-95269108 GAGCAGCCCAAAGGCTGCGGCGG - Exonic
1044915121 8:97105086-97105108 AAGAAGGCACAATGCCGGGGTGG - Intronic
1047262186 8:123273713-123273735 AGGCAGCCACACGCCCCCGGAGG + Intronic
1062027783 9:134348475-134348497 AAGCAGCCACATGGGCCCTGGGG - Intronic
1062538195 9:137030070-137030092 AAGCAGCCCCATGGCCGTGGGGG + Intronic
1189224015 X:39397706-39397728 CAGCAGACAAAAGCCCGCGGTGG + Intergenic
1198311136 X:135426362-135426384 AAGCAGGCAAAAGGCGGGGGAGG + Intergenic
1200240374 X:154490214-154490236 ATGCACCCACAAGGCAGGGGAGG + Intronic
1200278647 X:154757899-154757921 AAGCAGCCACAAGCCTGCTCAGG - Intergenic
1202044767 Y:20727109-20727131 CAGCAGCCAGGGGGCCGCGGCGG - Intergenic