ID: 1152632667

View in Genome Browser
Species Human (GRCh38)
Location 17:81417511-81417533
Sequence CAGGGGAGGGAGACCGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 1, 1: 1, 2: 6, 3: 102, 4: 892}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152632654_1152632667 24 Left 1152632654 17:81417464-81417486 CCTCAGTCCCCACCATGGCTGCT 0: 1
1: 0
2: 3
3: 57
4: 444
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632658_1152632667 12 Left 1152632658 17:81417476-81417498 CCATGGCTGCTCTGAGTCACTTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632657_1152632667 15 Left 1152632657 17:81417473-81417495 CCACCATGGCTGCTCTGAGTCAC 0: 1
1: 0
2: 2
3: 32
4: 271
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632649_1152632667 30 Left 1152632649 17:81417458-81417480 CCCCACCCTCAGTCCCCACCATG 0: 1
1: 0
2: 7
3: 64
4: 627
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632650_1152632667 29 Left 1152632650 17:81417459-81417481 CCCACCCTCAGTCCCCACCATGG 0: 1
1: 0
2: 2
3: 61
4: 501
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632656_1152632667 16 Left 1152632656 17:81417472-81417494 CCCACCATGGCTGCTCTGAGTCA 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632652_1152632667 28 Left 1152632652 17:81417460-81417482 CCACCCTCAGTCCCCACCATGGC 0: 1
1: 0
2: 4
3: 60
4: 596
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632653_1152632667 25 Left 1152632653 17:81417463-81417485 CCCTCAGTCCCCACCATGGCTGC 0: 1
1: 0
2: 4
3: 31
4: 321
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892
1152632655_1152632667 17 Left 1152632655 17:81417471-81417493 CCCCACCATGGCTGCTCTGAGTC 0: 1
1: 0
2: 5
3: 25
4: 194
Right 1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG 0: 1
1: 1
2: 6
3: 102
4: 892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152632667 Original CRISPR CAGGGGAGGGAGACCGAGGA GGG Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900475594 1:2874972-2874994 GGAGGGAGGGAAACCGAGGATGG - Intergenic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900605998 1:3523808-3523830 CAGGGGAGTGAGCCCGTGGGTGG - Intronic
900611680 1:3546948-3546970 CTGGGAAGGGAGGCCGAGGCAGG + Intronic
900887957 1:5428858-5428880 GGAGGGAGGGAGACAGAGGAAGG + Intergenic
901102013 1:6726330-6726352 GAGGGGCGGGAGACAGATGACGG - Intergenic
901177770 1:7317142-7317164 CAGGGAAGGAAGGCCTAGGATGG + Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901648004 1:10726983-10727005 GAGGGGAGGGAGACCGGGAGAGG + Intronic
901891843 1:12273561-12273583 CAGGGGATGGGGAGCGAGAAGGG - Intronic
901919350 1:12525401-12525423 CAGGGGAGGAGGATCCAGGAAGG + Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902689467 1:18101228-18101250 GAGGGGAGGGAGAAGAAGGAGGG - Intergenic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
902985065 1:20149955-20149977 CTGGGGAGGGAGAGCCGGGAAGG + Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903229137 1:21911391-21911413 CAGGGAAGGGTGACAGAGGAGGG - Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
903881176 1:26510547-26510569 GAGGGGAGGGAGAGAGATGAGGG - Intergenic
903886539 1:26544111-26544133 CAGGGCAGGGATCCCCAGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904401844 1:30262091-30262113 CTGGGGAGGGGGAACAAGGAGGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904532599 1:31179477-31179499 CAGGGCCGGGAGGCTGAGGAAGG - Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905462012 1:38128108-38128130 GAGGGGAGGGAGGACAAGGAGGG + Intergenic
905525906 1:38639298-38639320 GAGGGCAGGGAGACCAAGCAAGG - Intergenic
905868888 1:41391731-41391753 CAGGGGAGGAAGACAGAGGTGGG + Intergenic
906315238 1:44782782-44782804 CAGAGGAGGAAGACAGAGGGGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906959355 1:50407230-50407252 TTTGGGAGGGAGGCCGAGGAGGG + Intergenic
907317553 1:53582099-53582121 CAGGGTCAGGAGACCTAGGAGGG + Intronic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908355982 1:63324655-63324677 GAGGGGATGGAGGCCGCGGAAGG - Exonic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909629719 1:77759297-77759319 CTGAGTGGGGAGACCGAGGAAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
912161666 1:106992987-106993009 GAAGGGAGGGAGACGGATGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914197847 1:145459155-145459177 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
914476950 1:148032279-148032301 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915243593 1:154541256-154541278 CAGGGGAGGGATGGCGGGGAGGG + Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915627320 1:157122966-157122988 CAGGTGAGGGAGACAGTAGATGG - Exonic
915637383 1:157196036-157196058 CAGGGGAGGGAGGCTGAGATGGG + Intergenic
916053598 1:161052594-161052616 CAGGGGAGGAAGGCCCAGGAAGG + Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916356116 1:163910391-163910413 CAGGGTTGGGAGGCCGAGGCGGG + Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916723865 1:167505683-167505705 GAGTGGAGGGAGACCAAGGTAGG + Intronic
916860660 1:168801092-168801114 CAGGAGAGGGAGAGAGAGCAGGG + Intergenic
917082309 1:171268669-171268691 CAGGGGAGGGAGAAAGGAGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917389781 1:174522551-174522573 GAGGGGAGGGAGACGAGGGAAGG + Intronic
917839739 1:178968068-178968090 CAGGAGAGGGAAACAGAAGAGGG + Intergenic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918219916 1:182427471-182427493 CAGGTGAGGGAAACAGATGAGGG - Intergenic
918472270 1:184886274-184886296 CAGGGTAGGGAGGCGGGGGAGGG + Intronic
918642836 1:186864006-186864028 TTTGGGAGGGAGGCCGAGGAAGG - Intronic
920182892 1:204143443-204143465 CAGGGGAGGGAAGCAGAGCAGGG - Intronic
920278905 1:204828859-204828881 CAGGGGATGGAGACAGACGAGGG - Intronic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920671597 1:208007701-208007723 CAGGGGTGGAAGGACGAGGAAGG - Intergenic
921129695 1:212209052-212209074 CTGGGAATGGAGACAGAGGAGGG + Intergenic
921326124 1:213987724-213987746 CCGGGGATGGAGGCCGGGGAGGG + Intronic
921427531 1:215021792-215021814 CAGGCGTGGGAGGCCGAGGCGGG - Intronic
921584031 1:216927336-216927358 CAAGGGAGGGAGCCTGAAGACGG + Intronic
921588740 1:216979032-216979054 GAGGGGAGGGAGAGAGAGCATGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
922794037 1:228330279-228330301 CAGGGAAGGGAAACTGAGGTAGG - Intronic
923084734 1:230694785-230694807 CATGGGAGAGAGACAGAGAAGGG + Intergenic
923109507 1:230879742-230879764 CAGGGCAGGGTGATTGAGGAGGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923323419 1:232858954-232858976 CAGGGAAGGGAGAGCAGGGAAGG - Intergenic
923323423 1:232858968-232858990 CAGGGAAGGGAGAGCAGGGAAGG - Intergenic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
923498407 1:234544486-234544508 CAGGGGTGGGAGGCGGTGGAGGG + Intergenic
924606664 1:245541251-245541273 CAGGGGCAGGAGACCGAGGGAGG + Intronic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062961949 10:1578928-1578950 CTGGGGTGGGACACAGAGGAAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064518735 10:16178011-16178033 CAGGGGAGAAAGATCGAGGTTGG + Intergenic
1065286623 10:24193163-24193185 CAGGAGGGGGAGGCCGAGGTGGG - Intronic
1065794970 10:29298380-29298402 CAGAGGAGGGACACTGAGGTTGG - Intronic
1065976515 10:30847005-30847027 CATGGAAGGGAGGCTGAGGAAGG + Intronic
1067691473 10:48504747-48504769 CAGGGGAGGGAAGCAGAGGCTGG + Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069038630 10:63671618-63671640 TGGGGGATGGAGACAGAGGAGGG - Intergenic
1069620381 10:69833870-69833892 TTGGGGAGGCAGACCGTGGAGGG + Intronic
1069973967 10:72198062-72198084 GGGGGGAGGGGGAACGAGGAAGG + Intronic
1071052902 10:81473256-81473278 CATGGGACGGAGGCCAAGGAGGG + Intergenic
1071222061 10:83479046-83479068 CAGGAGAGGGAGACAGATGGAGG - Intergenic
1071471224 10:85985383-85985405 CAGTTGGGGGAGACCGAGGTGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072690720 10:97570896-97570918 CAGGGGATGGGGGCAGAGGAGGG - Exonic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1073063434 10:100745358-100745380 CAGGGGAGGGAGAAATGGGAGGG - Intronic
1073753752 10:106559048-106559070 CAGGGGCAGGAGTCAGAGGAAGG - Intergenic
1074532292 10:114305816-114305838 GAGGGGAGGCAGATCCAGGAGGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075513760 10:123093453-123093475 GTGGGGAGGGGGACCGAGAAGGG + Intergenic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075658089 10:124174893-124174915 CAGGGAAGGGAGAGCCAGGAAGG - Intergenic
1076612720 10:131736723-131736745 CAGAGGAGGGAGAGCCAGGATGG + Intergenic
1076638715 10:131900253-131900275 CAGGATTGGGAGACCGAGGCCGG + Intergenic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1077938805 11:6818192-6818214 CATGGGAGGGGGACTGAGGTAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1080382535 11:31788448-31788470 AAGGGGAGGGAGACAGAAAAGGG + Exonic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1081869770 11:46378026-46378048 CAGGGAAACGAGACAGAGGAAGG - Intronic
1082011001 11:47449417-47449439 CGGGGGAAGGAGAGCGAGGCTGG + Intergenic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082816798 11:57514716-57514738 ACGTGGAGGGAGACCCAGGACGG + Intronic
1082838396 11:57668262-57668284 TAGGGAAGGGGGACCGAAGACGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083397475 11:62401628-62401650 CAGGGGAGGGAGAGAGGGCAAGG - Intergenic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083850378 11:65362568-65362590 CAAGTGAGGGAGGCCAAGGAGGG + Intergenic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084016316 11:66384584-66384606 CTTGGGAGGGAGACAGAGGCGGG + Intergenic
1084162648 11:67358325-67358347 CAGTGGAGGGAAACAGAGGAGGG - Intronic
1084372081 11:68751105-68751127 CAGGGGAGGGAGTCAGGGGAGGG + Intronic
1084453880 11:69256285-69256307 CAGGAGAGAGAGCGCGAGGAAGG + Intergenic
1084939648 11:72605706-72605728 CAGGGGAGGAACACAGAGCAGGG + Intronic
1084953065 11:72677288-72677310 CCAGTGAGGGAGACAGAGGAGGG - Intergenic
1085245817 11:75099598-75099620 CAATGGAGTGAGACCCAGGAAGG + Intergenic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1089064275 11:115650580-115650602 AAGGGGAGGGGGACGGTGGATGG - Intergenic
1089652824 11:119925799-119925821 CAGGGGAGTGAGGCAGAGAAAGG + Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090421819 11:126580521-126580543 CAGTGGAGGCATACCGTGGAGGG + Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091796079 12:3298084-3298106 CAGGGGCTGGACACAGAGGAGGG + Intergenic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092140787 12:6182095-6182117 CAGGGGATGGGGACAGGGGATGG + Intergenic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092272103 12:7031386-7031408 CACAGGAGGGAGACCAAGGTGGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092445417 12:8551509-8551531 AAGGGGAGTGAGACAGAGTAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095444132 12:42267801-42267823 CACGGGAGGGAGGCCAAGGGGGG - Intronic
1095859297 12:46897864-46897886 CAGGAGAGGGAGAGAGAGAAAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097038879 12:56142479-56142501 CAGGTGAGGGACACCCAGGAGGG + Intronic
1097151708 12:56984110-56984132 CAGGGGAGAGAGACAGAGACAGG + Intergenic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097260263 12:57715908-57715930 TAGGGAAGGGTGACAGAGGATGG - Exonic
1097272576 12:57786223-57786245 CAAGGGAGGAAGACCAAAGAAGG + Exonic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098510349 12:71306036-71306058 GAGGGGAGGGAAATAGAGGACGG - Intronic
1098529843 12:71529343-71529365 CAGGAGAGAGAGAGCGAGGGGGG + Intronic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1099301476 12:80900011-80900033 TAGAGGAGGGAGGCCGAGGCGGG - Intronic
1100189709 12:92177347-92177369 GAGGGAAGGGAGGCTGAGGAAGG + Intergenic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102625740 12:114234208-114234230 CAGAGGAAGGAGACCCACGAAGG - Intergenic
1102712258 12:114938602-114938624 AGGGGGAGGAAGATCGAGGAGGG + Intergenic
1102884114 12:116508737-116508759 CAGGGCAGGGGGAACGGGGAAGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103703864 12:122861175-122861197 CAGGAGATGGAGACCCAGGTAGG + Exonic
1103825588 12:123735571-123735593 GAGCGGAGGGAGATCCAGGAGGG + Exonic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104378724 12:128288428-128288450 CAGGGGAGGGAAGGAGAGGAGGG - Intronic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1104753349 12:131253812-131253834 CAGGAGAGAGAGAGCGAGTAGGG - Intergenic
1104761358 12:131299100-131299122 CCGGGGAGGGAGGCCCAGGGCGG + Intergenic
1104818417 12:131661692-131661714 CCGGGGAGGGAGGCCCAGGGCGG - Intergenic
1104908488 12:132228264-132228286 CTGGGGAGGGACGCCGGGGAGGG - Intronic
1104914234 12:132256587-132256609 CAGTGGAGGGGGACAGTGGAGGG + Intronic
1104948780 12:132429425-132429447 CTGGGGAGGGAGACGGGCGAGGG - Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105604460 13:21915339-21915361 CAGGGGAGGGATGGCCAGGATGG - Intergenic
1106447671 13:29850666-29850688 CCGCGGAGGGAGGACGAGGACGG - Exonic
1107436612 13:40385987-40386009 AAGGGGAAGGAGACCTGGGAAGG - Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1108541562 13:51451910-51451932 GCGGGGAGGGCGAGCGAGGAAGG + Intronic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108909259 13:55522518-55522540 TAGGAGAGGGAGACAGAAGAGGG + Intergenic
1108984141 13:56561664-56561686 CAGGGGCGGGAGTGTGAGGAAGG + Intergenic
1109470602 13:62799332-62799354 CATGGGAGGGAGTTTGAGGAGGG + Intergenic
1109687748 13:65843643-65843665 CATGGAAGGGAGACAGAGGTTGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110117771 13:71841349-71841371 CAGGGAAGGGAGAGCGGGGAGGG + Intronic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1111144372 13:84161376-84161398 CAGGGGTGGGGGACGGGGGAGGG - Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112401943 13:99085840-99085862 CGGGGGAGGGATACGGGGGAGGG + Intronic
1112637155 13:101227633-101227655 CAGGGGAGGGAGTCCAATGCTGG - Intronic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1112769422 13:102779831-102779853 CAGGGTAGGGAGTCAGTGGATGG + Intergenic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113497679 13:110744808-110744830 CATGGGAGGGACCCAGAGGAAGG - Intergenic
1113754760 13:112803765-112803787 GAGGGGAGGGAGAGGAAGGAGGG - Intronic
1113861785 13:113491344-113491366 CCGGGGAGGGAGAGAGGGGAGGG - Intronic
1113861858 13:113491515-113491537 CCAGGGAGGGAGAGAGAGGAGGG - Intronic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114270727 14:21098457-21098479 CGGGGGCGGGGGACCGGGGAGGG - Exonic
1114534026 14:23411957-23411979 GAGGGGAGGCAGACAGATGAGGG - Intergenic
1114535109 14:23417692-23417714 CAGGGGAGGGTGGCAGAGGGTGG + Intronic
1115610724 14:35046445-35046467 CTGGGCGGGGAGACCAAGGATGG + Exonic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116982376 14:51185233-51185255 CAGGAGAGAGAGAGCAAGGAGGG + Intergenic
1118005942 14:61564186-61564208 CAGGGGAGGAATAACGAGGCAGG + Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118577785 14:67260874-67260896 CAGGGGAGGGAGAAAGAAAATGG + Intronic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119171818 14:72541423-72541445 CAGAGAGGGAAGACCGAGGAAGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119421196 14:74508966-74508988 CAGGGGAGGAAGACAGCCGATGG + Intronic
1119655436 14:76413904-76413926 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119655513 14:76414116-76414138 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119655519 14:76414134-76414156 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120993443 14:90397809-90397831 GAGGGGAGAGCGACCGAGGGAGG - Intronic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121608245 14:95257009-95257031 CAGGAGGGGGACACAGAGGAGGG + Intronic
1121916194 14:97838618-97838640 CAGGGCAGGGAGAGCCAGGGCGG + Intergenic
1122298180 14:100717232-100717254 CAGGGGTGGAAGACAGAGGGTGG - Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122803274 14:104243497-104243519 CAGGTGAGGGAGAACCAGCAAGG - Intergenic
1122956681 14:105074582-105074604 CAGGGGAGGGTCTCTGAGGAGGG - Intergenic
1122986046 14:105212071-105212093 CAGGGCAGGGAGACCTTGGGAGG - Intronic
1123028340 14:105439089-105439111 CAGGGCAGGGGCACCGAGTATGG - Intronic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123446657 15:20335754-20335776 CAGGGGTGGGGGACTGGGGAAGG - Intergenic
1124218900 15:27832437-27832459 CGGGGGAGGGAGACTGTAGATGG - Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1124355519 15:28992210-28992232 CTGGGGAGGGAGCCCGAGACAGG - Intronic
1124483897 15:30099781-30099803 AAGGGGAGGAAGACAGAGGGAGG + Intergenic
1124519682 15:30397443-30397465 AAGGGGAGGAAGACAGAGGGAGG - Intergenic
1124538971 15:30568778-30568800 AAGGGGAGGAAGACAGAGGGAGG + Intergenic
1124759678 15:32438794-32438816 AAGGGGAGGAAGACAGAGGGAGG - Intergenic
1124820806 15:33044166-33044188 CATGGGATGGAGGCTGAGGAGGG + Intronic
1124866675 15:33499174-33499196 AAGGGGAGGGAGAGAGAGGGAGG - Intronic
1125918508 15:43510448-43510470 AAGGACAGGGAAACCGAGGATGG + Intronic
1125968715 15:43894676-43894698 CAGGGGAGGGAGGCAGCGGAGGG + Intronic
1126115871 15:45207098-45207120 GAGGGGAGGGAGGCCGGGGAGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127332734 15:57954785-57954807 GAGGGGTGGGTGAGCGAGGAGGG + Exonic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127967915 15:63937560-63937582 GTGGGGAGGGAGCCAGAGGAGGG - Intronic
1128091494 15:64922084-64922106 CAGGGGTGGGGGACAGAGGTCGG - Intronic
1128735261 15:70050009-70050031 CAGGCGAGGGGCCCCGAGGATGG - Exonic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1129673986 15:77622482-77622504 CTGGGGAGGGAGACTCAGAAAGG + Intronic
1129698002 15:77751605-77751627 CAGAGGAGGGAGGGCCAGGATGG - Intronic
1129843630 15:78758393-78758415 CAGGGGCGGGAGGCTGGGGAAGG - Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131121003 15:89823453-89823475 CTGGGGAGGGAGCCCGCCGAGGG - Intergenic
1131450366 15:92534510-92534532 CACGGGAGGGACCCCGTGGAAGG + Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132362779 15:101231428-101231450 CAGGGGCCGGAGGCAGAGGAAGG + Intronic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1132777602 16:1604430-1604452 CAGGGCTGGAAGGCCGAGGAAGG + Intronic
1133020441 16:2964653-2964675 CTGGGGGCGGAGGCCGAGGAAGG - Intronic
1133206174 16:4235101-4235123 TAGGGAAGGGAGACCCAAGAGGG + Intronic
1133578943 16:7124492-7124514 GAGGGGAGGGGGAGCGAGGAAGG - Intronic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134242016 16:12513264-12513286 CTGGGGAGGGAGCACTAGGAAGG - Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134312946 16:13092811-13092833 CAGTGGGTGGAGACCAAGGAGGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134470577 16:14521688-14521710 CACGGGAGGGAGGCTGAGGCAGG + Intronic
1134911709 16:18033051-18033073 CAGGGGAGGAAGATGGAGGGAGG - Intergenic
1135300133 16:21319659-21319681 CAGGCTGGGGAGACAGAGGATGG - Intergenic
1135465404 16:22680553-22680575 GTGGGGAGGGAGGCAGAGGATGG - Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135673230 16:24392515-24392537 CAGGTGGGGGAAACTGAGGACGG - Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136170460 16:28486358-28486380 CAGGGCAGGGATACCCAGCATGG + Exonic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1138030007 16:53552443-53552465 CAGGGGTGTGAGACAGAGAAGGG - Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138505918 16:57478244-57478266 CAGGGCAGGGAGGCACAGGAGGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138564919 16:57826073-57826095 CAGAGGAGGGAGGCAGAGGACGG - Intronic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138756364 16:59490938-59490960 CAGGGGAGGGGGAGGAAGGAGGG - Intergenic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139625874 16:68188008-68188030 CATGGGAGGGAGGTCGAGGTAGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140306131 16:73804911-73804933 GAGGGGAGGGAGAGGGAGGGAGG + Intergenic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141156260 16:81599266-81599288 CAGGGGAGGGAGAGTGTGAACGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141558105 16:84849282-84849304 GGAGGGAGGGAGGCCGAGGAGGG - Intronic
1141704566 16:85657602-85657624 CAGGTGAGTGAGCCCCAGGAAGG + Exonic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142639275 17:1276285-1276307 GAGTGGAGGGAGCCCGAGGGAGG - Intergenic
1142670465 17:1485540-1485562 CAGGGGGAGGAGGCCGAGGCGGG - Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143029792 17:3961541-3961563 CAGGGGAGGGAGGCAGCGGCTGG - Intronic
1143346024 17:6249959-6249981 CTGGGGAGGGAGGCAGAGGGAGG - Intergenic
1143522226 17:7451386-7451408 CCGGGGAGGGAGGCTGAGGCAGG - Intronic
1143789041 17:9278777-9278799 CAGGGGAGGGAGATCGGGCAGGG + Intronic
1144454072 17:15404620-15404642 CAGGGGAGGGAGGCCTGGGCAGG + Intergenic
1144560967 17:16320137-16320159 AAGGGAAGGGAGAGAGAGGAAGG + Intronic
1145321530 17:21769989-21770011 CAGGGGAGGGCGCCCGGGGTGGG + Intergenic
1145398248 17:22512474-22512496 CTGGGGAGGGAAACTGAGAAAGG - Intergenic
1145398854 17:22515446-22515468 GAGGGGAGGGAGGGAGAGGAGGG + Intergenic
1145747604 17:27332038-27332060 CAAGGGTGTGAGACCAAGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146528989 17:33591813-33591835 GAGGGAAGGGGGACCGAGCAAGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146574409 17:33978833-33978855 CTATGGAGGGAGAGCGAGGAGGG + Intronic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147565609 17:41534832-41534854 CAGGGGTGGGGGCACGAGGATGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1148185145 17:45637544-45637566 CAGGGGACCGAGACCCAAGACGG - Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1148743972 17:49908249-49908271 CAGGACAGGGAGACAGAGCAGGG + Intergenic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150499584 17:65637664-65637686 GAGGGGAGGAACACAGAGGAGGG - Intronic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1150583799 17:66499276-66499298 CAGGGTAGGGAAACCAAGAAGGG + Intronic
1150711147 17:67531888-67531910 GAGGGGAGGGGGAGAGAGGAAGG - Intronic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1151762321 17:76112286-76112308 TGGGGGAGGGAGACAGAGGGAGG + Intronic
1152018880 17:77770238-77770260 CAGGGGAGGGAGAGAGAGAGAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152320794 17:79608091-79608113 CAGAGGAGGGAGGGCGAGGAGGG + Intergenic
1152470802 17:80489348-80489370 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1152470879 17:80489597-80489619 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1152470956 17:80489846-80489868 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1152521028 17:80857157-80857179 CAGGGGAGGGAGGGCGTGGAGGG - Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152660164 17:81538357-81538379 GAGGGCAGGGAGGCCCAGGATGG + Intergenic
1152677975 17:81651342-81651364 CAGGGGAGGGAACCAGAGGAGGG + Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152784665 17:82241527-82241549 CAGGGCAGGGAACCCCAGGAGGG + Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153597559 18:6743120-6743142 GAGAAGAGGGAGACCGACGAGGG + Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1156585363 18:38425820-38425842 CAGGGGAGGACAACTGAGGAAGG - Intergenic
1157232917 18:45935923-45935945 CAGAGGAGGAAGTCCAAGGAGGG - Intronic
1157368080 18:47084939-47084961 AAGGGGAGGGAGACGGTGGTGGG - Intronic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1157867297 18:51197512-51197534 CAGGGGAAGGAGGCAGAGGTAGG + Intronic
1157996394 18:52562169-52562191 CAGAGGAGGGATACTGAGTATGG + Intronic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160448647 18:78947027-78947049 GAGGGGAGGGAGGGCGAGGGAGG + Intergenic
1160549973 18:79688198-79688220 CAGGGGTGGGAGCCCCAGGCTGG - Intronic
1160768999 19:821977-821999 AAGGGGAGGGGGACGGGGGAGGG + Intronic
1161065649 19:2236101-2236123 CAGGGGCGGGAGGCCGGGGCCGG - Intronic
1161233358 19:3186443-3186465 CGGGGCAGGGAGACCTAGGCAGG - Intronic
1161266344 19:3366480-3366502 AGGAGGAGGGAGACCGAGGGAGG + Intronic
1161298365 19:3531118-3531140 CAGGGGAGCGAGTCCCAGGTGGG - Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161620168 19:5293336-5293358 CAGGGGACGGGCCCCGAGGAGGG + Intronic
1161628530 19:5340076-5340098 CAGGGGAGGGAGACCCGGAGAGG + Intronic
1161632399 19:5364813-5364835 CAGGGGATGTGGAACGAGGATGG + Intergenic
1161864608 19:6824964-6824986 CAGGGGAAGGAGACAGAGAGAGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162070910 19:8151590-8151612 CTGGGGAGGGAACCCCAGGATGG + Intronic
1162131174 19:8526984-8527006 CAGGTGAGAGAGACAGATGAAGG + Intronic
1162145537 19:8610740-8610762 CAGGGGAGGGGGCGCGGGGAAGG + Intergenic
1162164996 19:8746450-8746472 CAGAGGCGGGAGGCCGAGGCAGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162931361 19:13959458-13959480 GAGGGGACGGAGCCGGAGGATGG + Exonic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163551251 19:17967362-17967384 CAGCTCAGGGAGCCCGAGGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164835245 19:31351455-31351477 CGGGGCAGGGAGTCCGAGGCGGG + Intergenic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165336285 19:35172228-35172250 TTTGGGAGGGAGACCGAGGTGGG + Intergenic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165739183 19:38195526-38195548 CAGGGAGGAGAGGCCGAGGAAGG - Intronic
1165757690 19:38304013-38304035 CAGGGGAGGCCGACTGAGGGGGG - Intronic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166219258 19:41354268-41354290 CAGAGGAGGGGGACCCAGAACGG + Intronic
1166633294 19:44427036-44427058 CAGGAGAGAGACAGCGAGGAAGG + Exonic
1166776459 19:45315770-45315792 GAGGGGAGAGAGACAGAGAAGGG - Intronic
1166851639 19:45764203-45764225 CAGGGGCTGGAGGCCCAGGAGGG - Exonic
1166894770 19:46016467-46016489 CAGGGGATGGAGACTGATGGTGG - Intronic
1167112821 19:47471950-47471972 GAGGGGAGGGACACGGGGGAGGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167270174 19:48501952-48501974 CAGGGGAGGGGGGCAGGGGAGGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168287382 19:55341369-55341391 CAGGGGGCGGAGACCGAGGCTGG + Intronic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168641637 19:58034783-58034805 CAGGGGAGGGGCAGCGACGACGG - Intronic
1168690391 19:58373205-58373227 TGAGGGAGGGAGATCGAGGAAGG - Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925317835 2:2939036-2939058 CAGGGGTGGGACACAGGGGACGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926891593 2:17643854-17643876 CAGGGGAGGGAGAGCCAGCAAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928239372 2:29573114-29573136 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928596218 2:32861748-32861770 GAGGGGAGGAAGATCGTGGATGG - Intergenic
928899829 2:36304972-36304994 CATGGGAGGAAGAGCGAGGGAGG - Intergenic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930769689 2:55119088-55119110 CAAGGGAAGGAGACAGAGGTGGG + Intergenic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
931300436 2:60973568-60973590 TACGGGAGGGAGGCCAAGGAGGG + Intronic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932614446 2:73223140-73223162 CAGGGGTGGGAAACTGAGGAAGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933057760 2:77694708-77694730 TAGGGGTGGGAGGCAGAGGATGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
934056123 2:88253000-88253022 GAGGGGAGGGAGACGAGGGAGGG - Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
935446862 2:103166478-103166500 CAGGGGAGGGGGCCGCAGGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936500244 2:113060984-113061006 CAGGGGAGGGGGCCTGAAGAGGG + Intronic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
936918914 2:117668001-117668023 GAGGGGAAGAAGACCGTGGAAGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937438908 2:121900671-121900693 CAGGGGCGGGGGACCAGGGAAGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937977012 2:127588571-127588593 CAGGGGTGACAGACCCAGGAGGG - Intronic
938127673 2:128686255-128686277 CAGGGGAAGGAGCCCCAGGATGG - Intergenic
938241474 2:129745345-129745367 CAGGTGAGGGAGAAAGAGAATGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938671372 2:133589508-133589530 CAGGAGAGAGAGACCCAGGATGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939337480 2:140849064-140849086 TAGGGGAGGGAGGCCGGGCATGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
943082806 2:183276852-183276874 GAAGGGAGGGAGAGAGAGGAAGG - Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944851272 2:203721931-203721953 GAGGGAAGGGAGAGAGAGGAAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945266409 2:207895503-207895525 CAGGGGAAGGAGACTGTGAAAGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946903731 2:224396413-224396435 GAGGGGAGCTAGGCCGAGGAGGG - Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
948109532 2:235443682-235443704 CAGGGGAGGGACAAGAAGGAGGG - Intergenic
948572627 2:238927169-238927191 CAGGGGCGGGGCACAGAGGAGGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948843982 2:240674507-240674529 CAGGGGTTGGAGCCCCAGGAAGG - Intergenic
948849830 2:240700128-240700150 CAGGGGTTGGAGCCCCAGGAAGG + Intergenic
1168962145 20:1877095-1877117 CAGGGGATGGATACAGGGGATGG - Intergenic
1168962149 20:1877108-1877130 CAGGGGATGGACACAGGGGATGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169228943 20:3874269-3874291 CAGGGGAGGGATACTGGGGAGGG + Exonic
1169468290 20:5860750-5860772 AAGGGGAGGGAGACAGATGCTGG - Intronic
1169525998 20:6426323-6426345 AAGGGGAGGGAGAGAGAGGGAGG - Intergenic
1170308223 20:14963358-14963380 CAGGGGAAGGAGACCTGGGAGGG + Intronic
1170431029 20:16277000-16277022 CGGAGGAGGGAGTACGAGGAGGG - Intronic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1170934761 20:20800113-20800135 CAGGGAAGTGAGATCCAGGAGGG + Intergenic
1171029365 20:21663419-21663441 TAGGGTAGGGAGAACGAGGAGGG + Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171240785 20:23565634-23565656 CAGGGGAGGAAGACCAGAGAGGG + Intronic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172703098 20:36864258-36864280 CAGGAGAGGGAAGCCGAGGCAGG - Intergenic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1173164012 20:40673540-40673562 CAGGGAAGGAAGACCTTGGAAGG - Intergenic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1174564079 20:51452268-51452290 CAGGGGAAGGAGACTTGGGAAGG - Intronic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1174857957 20:54064622-54064644 CAGGAGAGCGAGACTGCGGAGGG - Intronic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175503316 20:59465476-59465498 AGGAGGAGGGAGACAGAGGAAGG - Intergenic
1175871971 20:62213215-62213237 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872006 20:62213300-62213322 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872062 20:62213435-62213457 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872133 20:62213607-62213629 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175872170 20:62213694-62213716 TGGGGGAGGGAGAGCGGGGATGG + Intergenic
1175940148 20:62533998-62534020 CAGGGGCGGGAGCCCCAGGCTGG + Intergenic
1175996734 20:62815341-62815363 CAGGGGAGAGCCACTGAGGAGGG + Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176547807 21:8209026-8209048 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176555699 21:8253228-8253250 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176566750 21:8392063-8392085 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177037457 21:16061090-16061112 CATGGGAAGGAGGCCGAGGTGGG - Intergenic
1177188504 21:17824002-17824024 AAGGGGAGAGAGACAGAGCAAGG + Intergenic
1177262557 21:18749834-18749856 CACAGGAGGGAGGCCAAGGAGGG + Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177899269 21:26893842-26893864 AAGAGGAAGGAGACCAAGGAAGG - Intergenic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1179008530 21:37535005-37535027 CAGGAGAGGGAGACCCAGAGAGG + Intergenic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179646525 21:42779424-42779446 CAGGGCAGGGAGTCCCAGGGTGG - Intergenic
1179646962 21:42782032-42782054 GAGGGAAGGGAGGCAGAGGAGGG - Intergenic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1180012607 21:45060696-45060718 CAGGGGAGGGCGATGGAGGGAGG + Intergenic
1180094753 21:45550848-45550870 GAGGGGAGGAAGGCAGAGGAGGG - Intergenic
1180116136 21:45706457-45706479 GAGGGGAGGGAGAGAAAGGAGGG - Intronic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183007607 22:34916516-34916538 AAAGGGAGGGAGACGGAGGGAGG + Intergenic
1183024997 22:35058370-35058392 CATGGGAGGGAAGCCGAGGAGGG - Intergenic
1183483320 22:38076470-38076492 CAGGGGTGGGACATGGAGGAGGG + Intergenic
1183674518 22:39292055-39292077 CAGGGGGTGGGGACCCAGGAAGG + Intergenic
1184106581 22:42370903-42370925 CAGGGGATGGATTCCCAGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184216425 22:43070426-43070448 CAGGGAAGGGGTACGGAGGAAGG + Intronic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184737654 22:46408870-46408892 CAGGGGCGGGCGCCGGAGGAAGG + Intronic
1185039141 22:48495557-48495579 CAGGGAAGGGAGAACAAGGATGG - Intronic
1203252681 22_KI270733v1_random:125311-125333 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
951014552 3:17715810-17715832 AAGGGGGGGGAGGCCGAGGTGGG + Intronic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
951761883 3:26157183-26157205 TAGGCGTGGGAGACCGAGGTGGG - Intergenic
953099581 3:39810987-39811009 CAGGGGAGGAAGACTGAGACTGG + Intronic
953473767 3:43188952-43188974 CAGGGCAGGGGGACTGAAGAGGG - Intergenic
954082310 3:48219829-48219851 CTGGGGAGGGAGTCCTGGGATGG - Intergenic
954257868 3:49418847-49418869 CAGGGAAGGGAGGCTCAGGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954435505 3:50493800-50493822 AAGGGCAGGGAGCCGGAGGAGGG + Intronic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955349762 3:58184704-58184726 AAGGGGAGAGAGACTGAGCATGG + Intergenic
955972998 3:64454419-64454441 CAGGGGAGGGGGCGAGAGGAGGG + Intergenic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957787921 3:84905310-84905332 CATGGGAGGGAGCCCGAGAGGGG + Intergenic
958468100 3:94483281-94483303 CAGGGCAGGGAGTGCCAGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959583239 3:108003117-108003139 CTGGGGATGGAGACGCAGGAGGG - Intergenic
960179847 3:114562786-114562808 CAGGAGAGGGAGAGAGATGAAGG + Intronic
960659858 3:120045569-120045591 CAGGGGAGTGACACTGAGGTAGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960996717 3:123345096-123345118 CATGGGAGAGAGACAGAGGGAGG + Intronic
961464549 3:127073305-127073327 CAGGAGAGGAAGGCCTAGGAGGG - Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961639935 3:128358716-128358738 CAGGTGAGGGAGACCGCTGGGGG + Intronic
961719636 3:128884440-128884462 CAGGGGAGGGAGATGGATGTGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
963613993 3:147511407-147511429 CAGGGGTGGGAGACAGGGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964075160 3:152684332-152684354 CAGTGGAGGGAGACCCAGAATGG + Intergenic
964208088 3:154196778-154196800 CTGGGGAGGGAAACGGGGGAAGG + Intronic
964989788 3:162794907-162794929 AAAGGGAGGGAGACGGAGAATGG + Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
965821297 3:172686896-172686918 TGGGGGAGGGAGAGCTAGGAAGG + Intronic
966099644 3:176251140-176251162 GAGGGGAGGGAGAAAGAGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967298614 3:187990101-187990123 CAGGGGAGGGAGAACAAACAAGG - Intergenic
967992505 3:195142083-195142105 CAGGGGAGAGAGGCTGTGGAGGG - Intronic
968225291 3:196969030-196969052 CCGGGGAGGGAGCCCGAGCGCGG - Intronic
968319073 3:197749837-197749859 CCGCGGGTGGAGACCGAGGACGG + Exonic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968460037 4:720231-720253 CTGGGGAGGGTGACCGCGGGAGG + Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968887446 4:3341944-3341966 CAGTGCAGGGAGACCCAGGCGGG + Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969489485 4:7490994-7491016 CAGGGCAGGGACAGAGAGGAGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970523548 4:16909345-16909367 CAGGGGAGGGAAAGAGAGGCAGG - Intergenic
972318587 4:37951008-37951030 CATTGGTGGGAGGCCGAGGAGGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973708433 4:53602303-53602325 CAGGGGATGGAGGCTGAGAAAGG + Intronic
973768131 4:54182256-54182278 CAGGCGTGGGAGGCCGAGGCAGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974686863 4:65242288-65242310 CATGGGATGGAGGCTGAGGAGGG - Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976266507 4:83190482-83190504 CAGGGGAGGGAAATCCAGAAAGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977607259 4:98995657-98995679 GAGGGGAGAGAGACCGAGTCGGG - Exonic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273570 4:118791535-118791557 CCGTGGAGGGAGAGAGAGGAGGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
981237284 4:142434289-142434311 CAGGTGAGGGAGACCAAGTCAGG + Intronic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981925580 4:150136102-150136124 GAGGGGAGTGAAACCAAGGATGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983079351 4:163366078-163366100 CAAGGGAGGGACACAGTGGAAGG + Intergenic
983452001 4:167923192-167923214 CAGGGAAGGGAGACAGGGGTGGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983695065 4:170518100-170518122 CAGGGGAGGGAAACACAGGTGGG + Intergenic
984139997 4:175993138-175993160 GAGGGGAGGGAGAGAGGGGAGGG - Intronic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984702328 4:182826170-182826192 CAGGGGAGGGAGGCCGGAGCAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985704594 5:1393047-1393069 CTGGGGAGGGACACAGAGGACGG - Exonic
985768878 5:1796617-1796639 CAGGGGAGGCAACCCGAGGAGGG - Intergenic
985864428 5:2503229-2503251 CAGGGGAGGGAATTAGAGGAGGG - Intergenic
985890887 5:2714622-2714644 CAGGGGTGGGAGACCCATGGGGG + Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985946748 5:3191121-3191143 CAGGGGAGTGAGAGCAGGGAGGG - Intergenic
985965518 5:3336441-3336463 CCGGGGAGGGAGACAGAGCCAGG + Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986313709 5:6572544-6572566 CTGGGGAGGGGCGCCGAGGATGG - Intergenic
986449493 5:7850764-7850786 CAGGGGCGGGCGGCCGCGGAGGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988799900 5:34686775-34686797 CATGGGAAGGAGACAGAGCAGGG - Intronic
988927857 5:36007190-36007212 CAGGGGATGAAGGCCTAGGAGGG - Intergenic
989140187 5:38194273-38194295 CAGGAGAGGGAGACAGAGAGAGG + Intergenic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990989112 5:61668131-61668153 CAGGGGAAGAAGACCCAAGAAGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991518580 5:67467865-67467887 CAGGGGAGAGATACAGAAGAAGG + Intergenic
992381990 5:76246777-76246799 TAGGGGAGGGTGACAGAGGTGGG - Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
995945396 5:117638934-117638956 GAGGGGAGGCAGACCAGGGATGG - Intergenic
996277230 5:121681598-121681620 GCGGGGAGGGGGCCCGAGGAAGG - Intergenic
996642405 5:125772010-125772032 AAGGTGAGGGAGACAGAGGCAGG + Intergenic
996695766 5:126393131-126393153 CAGGGAAGGGAAACAGAGGAAGG - Intronic
997042851 5:130278109-130278131 TATGGGAGGGAGACTGAGTAGGG - Intergenic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997552943 5:134769650-134769672 CAGGGGTGGGAGGCCGAGGCAGG - Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
999640872 5:153672054-153672076 CAGGGAAGGGAGGCAGAGAAGGG + Intronic
1000094251 5:157957263-157957285 CAGGTGTGGGAGACTGAGAAGGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000143387 5:158428792-158428814 CAGTGGAGTGAGTCTGAGGAAGG - Intergenic
1000267454 5:159651438-159651460 TAAGGGAGGGAGACAGGGGATGG - Intergenic
1001291506 5:170466016-170466038 CAGATGTGGGAGACCAAGGAGGG + Intronic
1001680748 5:173555309-173555331 CTGGGCAGGGAGACAGAGGGAGG - Intergenic
1002012716 5:176296723-176296745 CAGGGGTGGGAGAATCAGGAGGG - Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002448648 5:179306814-179306836 CAGGGAAAGGACACCCAGGAAGG + Intronic
1003075020 6:2975999-2976021 CTGGGCAGGGAGACCTAGGAAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003319633 6:5038862-5038884 CCGCGGAAGGAGACCGTGGAGGG + Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003460381 6:6323040-6323062 CAGTGGAGGGAGACTGGGCAGGG - Intergenic
1003628426 6:7764855-7764877 TAGGGGAGTGAGGTCGAGGAGGG + Intronic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005110372 6:22274837-22274859 AAGGGGAGAGAAACAGAGGAGGG - Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005987097 6:30882309-30882331 AAGGGGAGGGAAGCCCAGGATGG + Intronic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006442015 6:34058895-34058917 AAGGGGAAGGAAGCCGAGGAGGG + Intronic
1006641265 6:35490983-35491005 AAGGGGAGGGAGACCAAGGCCGG + Intronic
1007218106 6:40256869-40256891 CTTGGGTGGGAGACAGAGGAGGG - Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007497708 6:42272360-42272382 AAGGGGAGGGTGGCCAAGGATGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010970134 6:82254064-82254086 CAGGGATGGGAGGCCGAGGCAGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1013164117 6:107574674-107574696 CAAGGATGGGAGAACGAGGATGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014109373 6:117602845-117602867 CAGGGAGGGGAGAGCAAGGAAGG + Intergenic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1014391632 6:120872248-120872270 CATGGGAGGGAGGCTGAGAAGGG + Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1016850816 6:148617101-148617123 CAGGGGAGGGGGATGGAGAAAGG - Intergenic
1017522399 6:155213754-155213776 CATGGGAGGCAGGCCAAGGAGGG - Intronic
1017592233 6:155990068-155990090 CAATGGAGGGAGGCGGAGGAGGG - Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017822949 6:158061935-158061957 GAGGGAAGGGAGGACGAGGAGGG - Intronic
1017931518 6:158959464-158959486 CTGGGGAGGGAGTCTGTGGAAGG + Intergenic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018549614 6:164980683-164980705 CATGGGAGGGACACAGAGGGAGG + Intergenic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1018926064 6:168207850-168207872 CAGGGGAGGGGGCTCCAGGAAGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019196175 6:170284414-170284436 CAGGGGAGGGAGGGAGGGGAAGG + Intronic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019479826 7:1261340-1261362 CAGGGGAGGATGGCAGAGGACGG + Intergenic
1019567695 7:1692704-1692726 GAGGGGAGGGAGCCCCAGGAGGG - Intronic
1019615766 7:1959803-1959825 CAGGTGAGGGAGGACGAGGGCGG + Intronic
1019695112 7:2441302-2441324 CAGGGGCAGGAGACCTAGGCTGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020011508 7:4808065-4808087 GAGGGGAGAGAGACAGAGGGAGG - Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020812496 7:12864267-12864289 CAGGGGAGGCAGGCCAAGGAGGG - Intergenic
1021136805 7:16974843-16974865 CATGGGAGGGACACCGTGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022157776 7:27677640-27677662 CAGTGCAGGAAGACCAAGGAAGG - Intergenic
1022417738 7:30192334-30192356 TAGGGGAGTGAGACAGAGAAAGG - Intergenic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026101460 7:67387885-67387907 GAGGGGAGGGAGACAGAGCAAGG + Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1028443563 7:90892671-90892693 CAGGGGAAGGAATCCGAGGAGGG - Intronic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029339902 7:99934233-99934255 CAGGGGAGAGAGGCCGAGAGAGG + Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029665782 7:101994109-101994131 GAGGGGAGGGAGATGGAAGAAGG - Intronic
1029704092 7:102266683-102266705 CCGGGGAAGGAGGCCCAGGAGGG + Intronic
1030199143 7:106884644-106884666 CAGGGGTGGGGGAGCAAGGATGG + Intronic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1032021571 7:128409701-128409723 CCGGGGCGGGCGGCCGAGGAGGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033761954 7:144445390-144445412 TAGGGCAGGGAGGCCGAGGCGGG + Intergenic
1033800507 7:144896193-144896215 TAGGGGAAGGAGACAGAGCAAGG + Intergenic
1034324682 7:150220087-150220109 CAGGGGTCGGTGACTGAGGATGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034768509 7:153749144-153749166 CAGGGGTCGGTGACTGAGGATGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035109133 7:156465477-156465499 CTGTGGAGAGAGACCGAGGCAGG - Intergenic
1035174016 7:157037712-157037734 AAGGGGAGGGAGCCTGGGGAGGG + Intergenic
1035189609 7:157154075-157154097 CTTGGGAGGGAGGCCGAGGTGGG + Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035678944 8:1473540-1473562 CAGGGGCTGGAGACTGGGGAGGG + Intergenic
1036129686 8:6097584-6097606 GAGGAGAGAGAGACCGAGGGGGG + Intergenic
1037006807 8:13791562-13791584 CAGGGGAGGTAGGCTGAGGGAGG - Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037709960 8:21347637-21347659 CAGGGGAGGGACATGGGGGAGGG + Intergenic
1037764464 8:21763756-21763778 CAGGGTAGGGGGACGGATGAGGG - Intronic
1037934175 8:22903535-22903557 CAGGGGAGGGAGTGCGTGAAGGG + Intronic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039554953 8:38468683-38468705 CAGGGGGCGGAGGCGGAGGAGGG - Intronic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040681917 8:49820772-49820794 AAGGGAAGGGAGACGGAGGGAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041059416 8:54021973-54021995 GAGGGGAGGGAGAAGGAGGGAGG + Intronic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1042759312 8:72253403-72253425 CAGGGGAGGGAGGCGGTGCAGGG + Intergenic
1042856572 8:73273504-73273526 CACAGGAGGGAGGCCGAGGTGGG + Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1044654595 8:94534574-94534596 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
1044774998 8:95678398-95678420 CATGGGAGTGAGGCCGAGGGGGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045367874 8:101493430-101493452 CGGGGGAGGGAGGCGGGGGAGGG - Intronic
1045399820 8:101802299-101802321 CAGGGGAGGGCGAGAGATGAGGG - Intronic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046839412 8:118840747-118840769 CAGGAGAGAGAGACCGAGAGTGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1049551809 8:143263509-143263531 CAGGGGAGGGAGAGCTGGGAGGG - Intronic
1049591801 8:143466119-143466141 CAGGTGAGGGACTCAGAGGAGGG - Intronic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1049826888 8:144674740-144674762 CACAGGAGGGAGCCCGAGGAGGG - Intergenic
1050205052 9:3187426-3187448 CAGGGGTGGGAGGGCAAGGAAGG + Intergenic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051483044 9:17579463-17579485 CGGGGGCGGGGGACCGAGGGTGG - Intronic
1051733280 9:20170398-20170420 TGGGGGAGGGACACCGAGGTAGG - Intergenic
1051779943 9:20679194-20679216 CAGGGGAGGGAGATCATGTATGG + Intronic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1052992185 9:34525231-34525253 CAGGGGAGGGAAATGGAGGCAGG - Intergenic
1053166190 9:35845897-35845919 CAGGGGTGGGAGTCTGAGGGTGG + Intronic
1053301137 9:36950476-36950498 CTTGGGAGGAAGACTGAGGAGGG - Intronic
1053445022 9:38146156-38146178 CAGGGGAGAGAGGCCAAGGCAGG + Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1053922806 9:43015089-43015111 GCGGGGAGGGTGACAGAGGAGGG - Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1055989893 9:82094203-82094225 CAGGGGAGGGAAACAGAGGAGGG + Intergenic
1056045784 9:82714149-82714171 CAGTGGAGGGACACTGAAGAAGG - Intergenic
1056349716 9:85737860-85737882 CAGGGTGGGGAGGCCGGGGAGGG - Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057389066 9:94627936-94627958 CAGGGGAGGGAGGTAGGGGAAGG - Intronic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057510864 9:95678613-95678635 CATGGGAGGGAGGCTGAGCAGGG - Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059467391 9:114477652-114477674 CAGGGGAAGGACACTGAGAACGG + Intronic
1059467957 9:114481293-114481315 CAGTGGAGGGATAACGAGGATGG + Intronic
1059733263 9:117077117-117077139 CAGGGGAGAGAGACAGAGGTTGG + Intronic
1060484692 9:124039676-124039698 GGGGGGAGGGAGAGCCAGGAGGG + Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060969836 9:127731713-127731735 CAAGGGTGGCAGACTGAGGAGGG + Exonic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061571673 9:131481699-131481721 CAGGGGAGGAAGACAGAGTCAGG - Intronic
1061691840 9:132339330-132339352 CTGGGCATGGTGACCGAGGAAGG + Intronic
1061783228 9:133007975-133007997 AAGAGGAGGGAGAGAGAGGAGGG - Intergenic
1061819817 9:133220841-133220863 CGAGGGAGGGAGAGAGAGGAGGG + Intergenic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1061958447 9:133975826-133975848 CAGGAGAGAGGGACCCAGGAAGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062161128 9:135080497-135080519 CAGGGGAGGCAGCCCGGGAATGG - Intronic
1062391777 9:136336758-136336780 CAGGGGCGGAAGCCTGAGGACGG - Intronic
1062438626 9:136558602-136558624 CAGGAGAGGGAGACAGCGAAGGG - Intergenic
1062503247 9:136860178-136860200 CAGGGCAGGGAGGGCAAGGATGG - Intronic
1203562135 Un_KI270744v1:66209-66231 CTGGGGAGGGAGACAGGGCACGG + Intergenic
1185492270 X:526714-526736 CTGGGGAAAGAGACCCAGGAAGG - Intergenic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186361329 X:8845160-8845182 CAGGTGAGGGAAACCAAGCAAGG + Intergenic
1186704098 X:12123852-12123874 CAGGAGTGGGAGACCAAGGTGGG - Intergenic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188369966 X:29357943-29357965 CCGTGGAGGGAAACCGAGCAAGG + Intronic
1189034337 X:37480112-37480134 GAGAGGAGAGAGACAGAGGAGGG + Intronic
1189297690 X:39930332-39930354 CAGGGTAGGGTGACGGAGGGTGG - Intergenic
1189308665 X:40005690-40005712 GTGGGGAGGGAGGCCGAGGCCGG - Intergenic
1189440940 X:41035300-41035322 CAGGGGTGGGGGACAGAGGGAGG + Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191021821 X:55868504-55868526 CAGGGAAGGGAGACAGGGGTGGG - Intergenic
1191857048 X:65635501-65635523 CAGGGGACGGAGACTGGGGTGGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1195010631 X:100729854-100729876 CAGGGGAGGGGGAATGAGGGAGG + Intronic
1195266520 X:103186123-103186145 GAGGGGAGGGAGTCGGAGGCTGG - Intergenic
1195394146 X:104392979-104393001 CAGGATAGGGACACAGAGGAGGG + Intergenic
1195857839 X:109349740-109349762 CAGGGGAGGTGGACTCAGGAGGG + Intergenic
1197753816 X:129981879-129981901 CAGGGGAGGGGTTCCGGGGAGGG + Intronic
1198101500 X:133426155-133426177 CTTGGGAGGGAGACTGAGGTGGG - Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198434588 X:136603820-136603842 CAGAGGAGGGAGACCAGAGAGGG - Intergenic
1198870835 X:141176302-141176324 CAGGGGAGGGATCCCGGGGATGG + Exonic
1199005737 X:142693903-142693925 CAGGGGCTAGAGACCGAGGTGGG + Intergenic
1199235607 X:145488803-145488825 CAGGTGAGGGAGAATGAGCAAGG + Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199982438 X:152928374-152928396 CAGGGGTGGGAGACCGGGGAAGG + Intronic
1200151435 X:153953302-153953324 CAGGCCAGGGTGACTGAGGACGG - Intronic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201411618 Y:13704199-13704221 CAGGGGACGGAGGGCGAGAAGGG + Exonic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic