ID: 1152633517

View in Genome Browser
Species Human (GRCh38)
Location 17:81421156-81421178
Sequence GGCCCCCAGCTGCCTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 486}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152633506_1152633517 27 Left 1152633506 17:81421106-81421128 CCAGGATGGGGCACTTGGTCTGA 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1152633517 17:81421156-81421178 GGCCCCCAGCTGCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 51
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152633517 Original CRISPR GGCCCCCAGCTGCCTCCGCC TGG Intronic
900099779 1:956860-956882 GGCACCCAGCTGCCCGCCCCTGG + Intronic
900134112 1:1106981-1107003 GGGCCTCAGCTGCCTCCACGCGG + Intronic
900371747 1:2335321-2335343 GGCCGCCTCCTGCTTCCGCCGGG - Intronic
900531683 1:3156906-3156928 GGCCTCCAGCTGCCTCGGTGGGG + Intronic
900613263 1:3553320-3553342 GGACCCCCGCTGCCTACCCCTGG + Intronic
900956304 1:5888126-5888148 TGCCCCGAGCAGCCTCGGCCTGG - Intronic
901323281 1:8351994-8352016 GGCCCCCATCTGCCTCCCCGTGG - Intergenic
901462369 1:9399455-9399477 GGTCCTCAGCTGCCTCTTCCAGG - Intergenic
901684423 1:10935641-10935663 GGTCCCAAGCTGCCACCACCTGG - Intergenic
901686741 1:10947558-10947580 GGCCCCCAGCCCCCACCTCCAGG + Intronic
903033200 1:20477710-20477732 GGCCCCCATTTGTCTCCCCCAGG - Intergenic
903170114 1:21547445-21547467 GGCCCTCAGCCTCCTCCTCCTGG + Intronic
903233923 1:21937482-21937504 GGCCCCCAGCCCCCTCCGCGCGG + Intergenic
903332319 1:22602442-22602464 GGCCACCTGCAGCCTCCACCCGG + Exonic
903646771 1:24900855-24900877 GACCCCCAGCTGCCTCCTGAGGG - Exonic
904479819 1:30786820-30786842 GGCCCCCAGCTTCCGCTGCCTGG + Intergenic
905589841 1:39153754-39153776 GGGCCACAGCTGCCTCTGCAGGG - Intronic
905761132 1:40559024-40559046 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
905937451 1:41836184-41836206 GGACTCCAGCTGCCTCAGTCGGG + Intronic
906117853 1:43367698-43367720 GGCCCCCATTTGCCTACACCCGG - Exonic
908356748 1:63329993-63330015 GGACTCCAGCTGCCCCTGCCTGG + Intergenic
910676642 1:89821849-89821871 GGCCCCCAGCTCCCTCCCACAGG - Intronic
911836266 1:102622948-102622970 GGCCCCCAGCTACCTCCTACAGG - Intergenic
912379400 1:109239242-109239264 GGCCCCCAGCTGGCATAGCCAGG - Intergenic
913654125 1:120945092-120945114 GTCCCCCAGCTGACTCTGCCCGG + Intergenic
914267326 1:146049437-146049459 GTCCCCCAGCTGACTCTGCCCGG - Intergenic
914644321 1:149639256-149639278 GTCCCCCAGCTGACTCTGCCCGG + Intergenic
914919663 1:151838642-151838664 GGCCGCCACCTGCCCCGGCCGGG - Exonic
915333075 1:155125659-155125681 GGCCCAAAGCTGTCTCCTCCAGG + Intergenic
915367333 1:155323531-155323553 CGCCCCCAGCAGCCGCAGCCCGG - Intronic
915458188 1:156053980-156054002 GCCCCCCAGGGGCCCCCGCCTGG - Intergenic
915549505 1:156624260-156624282 GGACCCCAGCTCCCTCTCCCAGG + Intronic
916549885 1:165839992-165840014 GGCCCACTGCAGCCTCTGCCGGG + Intronic
917451485 1:175151105-175151127 GGCCCCCTGCCGCCGCCGACAGG - Intergenic
917508050 1:175646984-175647006 GGCTCCCAGCTGCCCTCGGCAGG + Intronic
917636604 1:176943206-176943228 GACCCCCAGCTGGCACCTCCCGG - Intronic
918326669 1:183417482-183417504 GGCCTCCCGCAGCCTCCGCCCGG + Intronic
919892072 1:201982820-201982842 AGCCCCCGGCTCCCTGCGCCGGG - Exonic
919925037 1:202187764-202187786 AGCCCCCAGCAGCCCCAGCCCGG - Intergenic
920333313 1:205227916-205227938 CCCGCCCGGCTGCCTCCGCCCGG - Intergenic
920660526 1:207910853-207910875 CGCCCACAGCTGCTTCCCCCCGG - Intronic
920878439 1:209858798-209858820 GGGCCTCAGCTGCCTCCTCGCGG - Intergenic
921360839 1:214329835-214329857 CTCCCTCAGCTGCCTCTGCCTGG - Intronic
922535817 1:226379894-226379916 GGCCCCAAGCTGCCCCCTCCAGG - Intronic
922574124 1:226651101-226651123 GGCCCCCAGCTGTCTCTGGTGGG - Intronic
923490370 1:234478750-234478772 GGCCGCCAGCTGCGGACGCCCGG + Exonic
924772534 1:247089717-247089739 GGCTGCCAGCTGCCTCCCCAGGG - Intergenic
1062807008 10:429412-429434 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807018 10:429433-429455 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807028 10:429454-429476 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807038 10:429475-429497 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807048 10:429496-429518 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1064230744 10:13528342-13528364 GGTCCCCCGGTGCCTCCGCCGGG - Intronic
1064461039 10:15535152-15535174 GGGCCTTAGCTGCCTCCCCCAGG + Intronic
1065104852 10:22372537-22372559 GGTCCCCAGCAGCCTCCCTCAGG + Intronic
1065140281 10:22713797-22713819 GGCCCCCAGCAGCTCCCGCCGGG + Intronic
1065554924 10:26905762-26905784 GGGCCTCAGCTGCCTCCCCGGGG + Intergenic
1065965826 10:30769563-30769585 GGGCCTCAGCTGCCTCCCCAAGG - Intergenic
1066649292 10:37639911-37639933 AGCTCCCAGCTGCCTCCTCCAGG + Intergenic
1067003379 10:42638402-42638424 GGCCCCCGGCTGCCTGCTCCTGG + Intronic
1067032150 10:42885313-42885335 AGTTCCCAGCTGCCTCCTCCAGG + Intergenic
1067336819 10:45373597-45373619 GGCGCCCGCCTGCCCCCGCCAGG + Intergenic
1068554944 10:58448408-58448430 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
1072189496 10:93068493-93068515 TGCGCGCAGCTGCCTCGGCCAGG + Exonic
1072538148 10:96378774-96378796 GGCCCCCAGGTGCCTCCTGAAGG + Intronic
1072553384 10:96495806-96495828 GGTCCCCAGCTGCTCCTGCCTGG + Intronic
1072891535 10:99329488-99329510 GGCCCCCGGCCGCCGCCGCCTGG + Exonic
1073146298 10:101284229-101284251 GGCTCTCAGCCGGCTCCGCCAGG - Intergenic
1073454862 10:103630279-103630301 GAACCCCAGCAGCCTCTGCCAGG + Intronic
1073499026 10:103919173-103919195 GGCCACCACCTGCCTCCCCCGGG - Intergenic
1074670915 10:115789735-115789757 GACCCCCTGCTTCCTACGCCAGG + Intronic
1074855391 10:117469486-117469508 GGCCCCCAGGTGACTACTCCAGG - Intergenic
1074908782 10:117888347-117888369 GGCTCCAAGCTGCCTGCCCCAGG - Intergenic
1075273894 10:121076511-121076533 GCCCCCCAGCTGCCTTCACTTGG - Intergenic
1075631205 10:124001624-124001646 TGCCCCCAGCTTCCTCCTTCAGG - Intergenic
1076116888 10:127907205-127907227 GGCGCCCGGCTGTCTTCGCCGGG - Exonic
1076187829 10:128462682-128462704 CGCCCGCAGCTGCCCCTGCCAGG + Intergenic
1076372638 10:129964962-129964984 GGCACTCGGCGGCCTCCGCCGGG - Intergenic
1076590320 10:131578114-131578136 GGCTCCCAGCGCCCACCGCCAGG + Intergenic
1076897321 10:133318994-133319016 GGCTCCCAGCCGCCTGCCCCTGG - Intronic
1076915437 10:133421106-133421128 GTCCCACAGCAGCCTCCACCAGG + Exonic
1076993736 11:288808-288830 CGCCCCCGGCCGCCTCCACCTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077161266 11:1113683-1113705 TGCCCCCAGCTGGGTCCTCCTGG + Intergenic
1077333707 11:1994290-1994312 GGCCGGCAGCTCCCTCAGCCAGG - Intergenic
1077404730 11:2377855-2377877 GGCCCCCAGAAGCCCCGGCCCGG - Intronic
1078639999 11:13085442-13085464 GTCCCACAGCTGCCTGCCCCGGG - Intergenic
1080197816 11:29632404-29632426 GCCCTCCAGCTGCCTCTGCTTGG + Intergenic
1080503070 11:32888355-32888377 GGGCCTTAGCTGCCTCCCCCGGG - Intergenic
1080616270 11:33947457-33947479 GACCCCCAGCTTCCTCCCTCTGG + Intergenic
1083700888 11:64477053-64477075 AGCCCTCATCTGCCTCCGCCTGG + Intergenic
1083743700 11:64723741-64723763 GGCCCCCACCTCCCACCGTCCGG + Intergenic
1083808080 11:65087000-65087022 GGCCCCCAGCTTCCCCAGGCCGG + Exonic
1083900846 11:65642564-65642586 GAGCCCCAGCTGCCTGCGCCTGG + Exonic
1084180295 11:67442706-67442728 GGCCCCCGGTTGCATCCTCCCGG - Intronic
1084490897 11:69477755-69477777 AGCCCCAAGCTGCCACAGCCTGG + Intergenic
1084592950 11:70100976-70100998 GGCCCCCGGCTGCGTCCACGAGG - Intronic
1084638518 11:70409967-70409989 GGCCCGCGGCTGCCTATGCCAGG + Intronic
1084958576 11:72704218-72704240 GGCCTCCAGGTGGCACCGCCGGG + Exonic
1089178360 11:116564189-116564211 GGCTCCCCGCTGCCTCAGACAGG + Intergenic
1089286832 11:117412776-117412798 AGCCCCCAGCACCCTCCGGCAGG - Exonic
1089817563 11:121189897-121189919 GTCTCCCAGCTGCCTGCCCCAGG - Intronic
1090408836 11:126493763-126493785 TGCCCCCAGCTGGCCCCGCCTGG + Intronic
1090657917 11:128859978-128860000 GGCCCACACTCGCCTCCGCCGGG + Intronic
1091024711 11:132131830-132131852 GGCCCCCCGCTCCCACTGCCTGG + Intronic
1091093207 11:132792690-132792712 GGCCCCCACCTGCGGCCCCCAGG + Intronic
1202816687 11_KI270721v1_random:49472-49494 GGCCGGCAGCTCCCTCAGCCAGG - Intergenic
1091493189 12:950132-950154 GGTCCACCGCTGCCTCGGCCCGG - Intronic
1091563284 12:1630235-1630257 CGCCCCCAGCGGCCTCCCCGGGG - Intronic
1091880592 12:3974234-3974256 GGCTCCCAGCTTCCTCTGCTGGG - Intergenic
1092002420 12:5043753-5043775 GGGCCCCAGCTGCGCCCTCCGGG + Intergenic
1093583259 12:20807584-20807606 AGGCCTCAGCTGCCTCCCCCTGG - Intergenic
1094833213 12:34309908-34309930 GGACCTCAGCTGCCTCCCCATGG + Intergenic
1096745371 12:53723634-53723656 AGCCCCCATCAGCCTCCTCCAGG + Exonic
1096749790 12:53751556-53751578 GGCCCTCAGCCTCCTCCGCGCGG + Intergenic
1096983730 12:55743376-55743398 GGCCCTCGGCCGCCTCCCCCCGG - Exonic
1097253699 12:57655983-57656005 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
1101017647 12:100518860-100518882 GGCCCACAGCAACCTCCACCTGG + Intronic
1101901137 12:108792126-108792148 GGCCCCCAGCTCCCATCTCCAGG - Intronic
1102042139 12:109807882-109807904 GGACTCCAGCTGCCTGCGCTGGG + Intronic
1102278247 12:111599064-111599086 GGCTCCCGGCTGTCCCCGCCCGG - Exonic
1103041995 12:117703424-117703446 GTCCCTCAGTTGCCTCCCCCTGG + Intronic
1103238849 12:119397635-119397657 GGAGCCCAGCTGGCTTCGCCTGG + Intronic
1103760859 12:123249463-123249485 GGGCCTCAGCTGCCTCCCCGTGG - Intronic
1103933638 12:124463742-124463764 GGCCCCCAGCCGCCTTTGGCAGG - Intronic
1104093288 12:125533677-125533699 GGGCTCCAGGAGCCTCCGCCGGG - Intronic
1104601410 12:130156364-130156386 GGGGCTCAGCTGCCTACGCCTGG - Intergenic
1104692771 12:130839137-130839159 TGTCCCGAGCTGCCTCCGGCCGG + Exonic
1104739565 12:131163355-131163377 GTCCTCCAGCTGCTTCCGACAGG + Intergenic
1104904284 12:132205194-132205216 GTCCCCTAGCTGCATCCTCCGGG + Intronic
1105777623 13:23677969-23677991 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic
1106099352 13:26681197-26681219 GGCCCCCATCTGCCTCGGCGAGG + Exonic
1106600852 13:31185460-31185482 TCCACCCAGCTGCCTCCCCCAGG + Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107469764 13:40681175-40681197 GGCTGCCAGCTGCCTCGGGCAGG - Intergenic
1109638079 13:65149725-65149747 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic
1110497872 13:76190308-76190330 GGGCCTCAGCTGCCTCCCCGCGG + Intergenic
1110854189 13:80278796-80278818 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
1111951465 13:94712183-94712205 GTCCCCCAGCCCCCTCCTCCGGG - Exonic
1113481252 13:110623433-110623455 ACCACCCAGCTGCTTCCGCCTGG - Intronic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1114175732 14:20317942-20317964 GGCCCGCAACTCCCTCAGCCTGG - Exonic
1114566987 14:23639908-23639930 GGCCCTCAGCCGCCTCCCCAGGG - Intronic
1116311024 14:43326821-43326843 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
1117727325 14:58687419-58687441 GGGCCTCAGCTGCCTCCCCACGG - Intergenic
1118373363 14:65156605-65156627 GGCCTCCAGGTGCTTCTGCCAGG + Intergenic
1119331530 14:73798175-73798197 CGTCCCCACCTGCCTCCTCCAGG - Intergenic
1119662579 14:76462478-76462500 GGCCCCCACCTGCCAGCGCAGGG - Intronic
1121125476 14:91404030-91404052 AGCCCCACGCTGCCTCAGCCTGG - Intronic
1122126141 14:99579686-99579708 TGCCTCCCGCTGCCTCCCCCAGG - Intronic
1122148487 14:99708377-99708399 GGCCCCCACATGCATCAGCCAGG + Intronic
1122362260 14:101174443-101174465 GGCCTCCTGCTGCCTCTGCGTGG - Intergenic
1122647587 14:103205741-103205763 GGCCCCAAGCTGGCTTTGCCCGG + Intergenic
1122694209 14:103544990-103545012 GGCCCCCAGCCTCCTCCTCAAGG - Intergenic
1123035012 14:105468460-105468482 GGCCCCCACCTGACCCTGCCCGG + Intronic
1123115616 14:105892811-105892833 TTCCCCCACCTGCCTCCGGCCGG - Intergenic
1202852688 14_GL000225v1_random:31072-31094 CGCCCCCAGATGCCTCCGCGCGG + Intergenic
1124364553 15:29062823-29062845 GGCCCCAAGCTGCTGCAGCCGGG - Intronic
1124955555 15:34357862-34357884 GGCTCCCTGCAGCCTCCTCCTGG + Intergenic
1124983322 15:34583463-34583485 GGCCCCAGGTTGCCGCCGCCAGG + Intronic
1125005363 15:34810953-34810975 GGCCCACAGATGCCTTCTCCTGG - Intergenic
1125524913 15:40368650-40368672 GAGCCCCAGCTGCGCCCGCCTGG + Exonic
1125720119 15:41841346-41841368 GGCCCACCGCTGCCTCAGCCTGG + Intronic
1125728323 15:41879481-41879503 GGCCTCCAGCTGCCCCCACCTGG + Exonic
1126773836 15:52082743-52082765 GGCTCACAGCTGGCTCCACCAGG - Intergenic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1127658274 15:61075970-61075992 GCCTCCCAGCTGCCTCAGCAGGG - Intronic
1127766045 15:62186706-62186728 GGGCCTTAGCTGCCTCCCCCAGG - Intergenic
1128115504 15:65102414-65102436 GGCCCCCAGCAGCCTCCAACCGG - Exonic
1128745565 15:70111757-70111779 GGCAGCCAGCTGGCTCAGCCTGG + Intergenic
1128868858 15:71136973-71136995 GGCCTGCTGCTGCCTCCTCCTGG + Intronic
1129229118 15:74186952-74186974 GGTCCCTAGCTCCCTCCTCCAGG + Intronic
1129541043 15:76347150-76347172 GGCCCGCGGCAGCCCCCGCCTGG + Intergenic
1129677707 15:77641423-77641445 GGCACCCAGCTGCATCACCCCGG + Intronic
1131107546 15:89745135-89745157 GGCTCCCTGCTGCCTCTGCTGGG - Intergenic
1132016366 15:98320824-98320846 GGCCCCCACCTCCCCACGCCTGG - Intergenic
1132320016 15:100919091-100919113 GGCACCCGGCTGCCTCCACGCGG - Intergenic
1132336836 15:101053226-101053248 GGCCCGCAGGTGCCTCAGCATGG - Exonic
1132390258 15:101433583-101433605 TGCCTCTAGCTGCCTCCTCCAGG - Intronic
1132648654 16:1010544-1010566 AGCCCGCCGCTGCCTCTGCCCGG - Intergenic
1132859507 16:2063062-2063084 AGCCCCCAGCTGCGGCCGCCTGG - Intronic
1132932969 16:2468125-2468147 CGCCCCCGGCTCCCTGCGCCCGG - Intergenic
1134094590 16:11411179-11411201 GGCCCCCTCCTGCCTCGGGCTGG + Intronic
1134121332 16:11586829-11586851 GGCCCCCCGCTGTCTCCCGCTGG + Intronic
1135671269 16:24377650-24377672 GGCAGCCAACTGCCTCCACCTGG + Intergenic
1135848959 16:25944821-25944843 AGCCCCCAGAAGCCTCAGCCAGG + Intronic
1136264623 16:29107565-29107587 CGCCTCTAGCTGGCTCCGCCTGG - Intergenic
1138505305 16:57475467-57475489 GGCCTCCATCTGCCTCCCCTGGG - Intronic
1139372797 16:66479232-66479254 CATCCCCAGCTGCCTCTGCCCGG + Intronic
1139387222 16:66580326-66580348 TGCACCCAGCTGCCTCTGCCTGG - Intronic
1139436160 16:66937824-66937846 GGCCCCAAGGAGCCTCAGCCTGG + Intronic
1139637066 16:68264326-68264348 AGCCCCCAGCTGCCTCGTCAGGG - Intergenic
1141912403 16:87068879-87068901 GGCCTCCAGCCGCCTTTGCCCGG - Intergenic
1142105241 16:88299094-88299116 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142105253 16:88299127-88299149 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142105276 16:88299192-88299214 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142105286 16:88299225-88299247 CGCCGCAAGCTGCCTCCTCCAGG - Intergenic
1142614886 17:1128258-1128280 GGTCCCCATCTTCCTCCCCCAGG - Intronic
1143509000 17:7384914-7384936 AGCCCCAAGCTGCCTCCCCAGGG - Intronic
1143630765 17:8139011-8139033 CGCCTCCAGCCGGCTCCGCCCGG + Intergenic
1143697432 17:8630723-8630745 AACCCACCGCTGCCTCCGCCGGG + Exonic
1143875521 17:9987934-9987956 GGCCCCCAGTGGCCTCCTGCTGG + Intronic
1146009236 17:29180356-29180378 GGCATCCAGCAGCCTCGGCCCGG + Exonic
1146032324 17:29376810-29376832 GGACCACAGCTGACTCTGCCAGG + Intergenic
1146439057 17:32877326-32877348 GCCACCCAGCTGCCGCCGCCCGG - Intergenic
1146443577 17:32917863-32917885 GGCACCTAACTGCCACCGCCTGG + Intergenic
1146788011 17:35735039-35735061 GGCCCTCTGCGGCCTCCACCTGG - Exonic
1147363161 17:39944036-39944058 AGCCCCCAGGTGCCTCCCCGGGG + Exonic
1148756953 17:49978209-49978231 GTCCCCCTCCTGCCTCCTCCTGG - Intergenic
1149470914 17:56914291-56914313 GGCCCCCAGAAGCCTCCGGGTGG - Intergenic
1149753991 17:59172739-59172761 GGGCCTCAGCTGCCTCCCCGTGG + Intronic
1150227456 17:63531694-63531716 GCCCCCCAGCTGCTTACTCCAGG + Intronic
1150438060 17:65169368-65169390 GGCCCCCAGATACCTGCGTCAGG - Intronic
1151348232 17:73516311-73516333 GGGCCACAGCAGCCTCCTCCTGG - Intronic
1151421209 17:73999135-73999157 TCCCCCGTGCTGCCTCCGCCTGG + Intergenic
1151490654 17:74430935-74430957 CGCCACCAGCTGGCTCCGACCGG + Exonic
1151586624 17:75012692-75012714 GGCCACCAGGTGCCTGCGCTGGG + Exonic
1151683020 17:75631560-75631582 GGCCTCCAGCCGCCTCCGCACGG + Exonic
1151782810 17:76258542-76258564 GGCCCCCAGCTGCCCAGGCCAGG - Intergenic
1152242908 17:79169500-79169522 GGACCCCGCCTGCCTCCGCCAGG + Intronic
1152260257 17:79262989-79263011 AGGCCTCAGCTGCCTCCCCCGGG + Intronic
1152436485 17:80279309-80279331 GGCCCCCACCTGCCTGGGCCTGG - Intronic
1152571366 17:81122659-81122681 GGCCCCACGCCGCCCCCGCCGGG + Exonic
1152633517 17:81421156-81421178 GGCCCCCAGCTGCCTCCGCCTGG + Intronic
1152713736 17:81888212-81888234 GGCCCCCAGCTGGCTCCCCCGGG + Intronic
1152758684 17:82097630-82097652 GGTCCCGAGCAGCCCCCGCCCGG - Intronic
1153868726 18:9297153-9297175 GGGCCTCAGCTGCCTCCCCGTGG + Intergenic
1154954786 18:21242791-21242813 GCCCCCTCGCCGCCTCCGCCGGG - Intronic
1155003334 18:21706734-21706756 GGGCCTCAGCTGCCTCCCCACGG + Intronic
1156460503 18:37319014-37319036 GGCCTCTGGCTGCCCCCGCCTGG + Intronic
1156657843 18:39309310-39309332 GGGCCTCAGCTGCCTCCCCACGG + Intergenic
1158160769 18:54480735-54480757 GTCTCCCAGCAGCCTCCGGCTGG - Intergenic
1158357656 18:56638675-56638697 GGCACCCAGCAGCCACCGCGCGG + Intronic
1158454375 18:57593485-57593507 GGGCACCAGCAGCCTCTGCCTGG - Intergenic
1158647955 18:59264435-59264457 TGCCCCCAGCTTCCTGCGCGTGG + Intergenic
1158976690 18:62716435-62716457 GGCCCGGAGCCGCCGCCGCCCGG + Exonic
1160224179 18:76999277-76999299 GGCCCTCAGCGGTCTCCTCCGGG - Intronic
1160238181 18:77102169-77102191 GGCCCTCAGCAGCCTGGGCCGGG + Intronic
1160441879 18:78899390-78899412 GGCCCCCATCTCCCTGAGCCTGG + Intergenic
1160679261 19:405293-405315 TGCCCCCGCCTGCCTCCACCCGG + Intergenic
1160739604 19:679870-679892 GGGCCCCAGCTGCGTCAGCCTGG - Intronic
1160846181 19:1167202-1167224 GGCCCTCAGTTCCCTCCTCCAGG - Intronic
1160894953 19:1397986-1398008 TCCCTCCAGCTGCCTCCACCTGG - Intronic
1160990813 19:1859639-1859661 GGCCTCAGGCTGCCTCCTCCAGG + Intronic
1161096182 19:2392568-2392590 GGAGCCCAGCTGGCTTCGCCCGG - Intronic
1161219842 19:3113510-3113532 GGCCCGCAGCTGCCGTCCCCAGG - Intronic
1161234945 19:3193151-3193173 GGCCCCCTGCTACCCCCTCCAGG + Intronic
1161234958 19:3193185-3193207 GGCCCCCTGCTACCCCCACCAGG + Intronic
1161562551 19:4981548-4981570 GGGGCCCAGCAGCCTCCACCTGG + Intronic
1162412996 19:10517634-10517656 AGCCCTCAGCTGCCCCCTCCGGG + Intronic
1163138823 19:15332566-15332588 GGCCCCGCGCCGCCGCCGCCCGG + Intergenic
1163154562 19:15432735-15432757 GGCGCTCAGCTGCTCCCGCCTGG - Intronic
1163303523 19:16462825-16462847 TGCACCCAGCTGCTTCCTCCAGG + Intronic
1163385428 19:16997171-16997193 GTCCACCAGCTGCCTCTGCACGG + Exonic
1163578593 19:18124668-18124690 GGCCCTCAGCCGCCTCCAGCAGG - Exonic
1163666447 19:18606120-18606142 GGCCCCCAGCGGGCCCCCCCAGG - Intronic
1164604560 19:29588249-29588271 GGCCTCCAGCTGCATCCAGCTGG + Intergenic
1164792634 19:31001370-31001392 GTCCCACAGCTGCCTCTGTCCGG + Intergenic
1165421411 19:35723811-35723833 GCCCCCCAGCTCCCGCCCCCCGG - Exonic
1165896569 19:39145226-39145248 AGCCCCCAGGTGCCTCCCCCAGG + Intronic
1166333210 19:42090512-42090534 GGCCCCCAGCTCTCCCCACCTGG - Exonic
1166361615 19:42254969-42254991 CGCCCCCACCTGTGTCCGCCGGG + Exonic
1166378924 19:42344446-42344468 AGCCGCCAGCTGCCTGGGCCTGG + Exonic
1166569484 19:43784739-43784761 GACCCCCAGCTTCTTCCTCCTGG - Intergenic
1167080920 19:47275494-47275516 GGCCCCGAGCTGACACCCCCTGG - Exonic
1167119533 19:47508236-47508258 GGCCCCCGGCTCCCTGTGCCAGG - Intronic
1167291939 19:48629357-48629379 GACCACCTGCTGCCTCCGCTGGG + Exonic
1167423587 19:49417752-49417774 TGCCCACAGCTGCCCTCGCCAGG - Exonic
1167468131 19:49660928-49660950 GGCCCTCTGCTGCCTCGACCAGG + Intronic
1168339318 19:55614480-55614502 GGCCCCCACCTCCCGCCGCTGGG + Exonic
924967390 2:91208-91230 GGGCCTCAGCTGCCTCCCCGCGG + Intergenic
925294430 2:2768023-2768045 GGCCTCCAGCAGGCTCTGCCTGG + Intergenic
925410282 2:3635785-3635807 GGCCCCCAGCTGCCAGCATCAGG + Intronic
925532988 2:4884422-4884444 GGGCCTCAGCTGCCTCCCCAGGG + Intergenic
925635906 2:5941324-5941346 GGCCCTCAGCTGCCAGGGCCAGG + Intergenic
925637830 2:5959343-5959365 CTCCCCCAGCTGCCTCTGTCAGG - Intergenic
925759214 2:7168189-7168211 GGCCCCCAGCTAGGGCCGCCTGG - Intergenic
927936804 2:27080710-27080732 GGCCTCCTTCTGCCTCTGCCAGG + Exonic
927942178 2:27111654-27111676 GGGCCTCAGCTGCCTCCCCGCGG - Intronic
928278235 2:29921378-29921400 CGCCCTCAGCTGCTGCCGCCGGG - Exonic
929138002 2:38643212-38643234 GGGCCTCAGCTGCCTCCTCGCGG - Intergenic
932355980 2:71068723-71068745 GGGCCCAGGCTCCCTCCGCCGGG - Intronic
932702458 2:74001146-74001168 GGCCCATACCTGCCTCCCCCTGG - Intronic
932790122 2:74648014-74648036 GGCCCGGAGCTTCCTCCGCGGGG - Exonic
933894615 2:86799456-86799478 GGCCCCCAGATGACTCTACCTGG - Intronic
934557253 2:95294031-95294053 TGCCCCAAGCTGCCACCCCCAGG + Intergenic
934859879 2:97755675-97755697 GGCCCCCAGAGCCCTCCCCCAGG + Intergenic
935663025 2:105486187-105486209 GGCCCACAGGTGCCACTGCCTGG - Intergenic
936012934 2:108936548-108936570 GGCCACCAGCAGCCTCCCCTTGG - Intronic
936783742 2:116067421-116067443 GGCCTCCAGCTGCATCCACATGG - Intergenic
938243506 2:129760757-129760779 GGTCACCACCTGCCTCCGCCAGG + Intergenic
942170237 2:173282732-173282754 GGGCCTCAGCTGCCTCCGCGCGG - Intergenic
942947331 2:181684320-181684342 GGAGCCCAACTGCCTCCCCCGGG - Intergenic
943222860 2:185132829-185132851 GGGCCTCAGCTGCCTCCCACGGG + Intergenic
943520605 2:188944579-188944601 GGGCCTCAGCTGCCTCCCCACGG - Intergenic
945664214 2:212721213-212721235 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
947122935 2:226836155-226836177 GGCCGCCAGCTCCCGCAGCCCGG - Intronic
947712040 2:232321856-232321878 GGCCCCCTGCAGCCACCGCCTGG - Intronic
947731279 2:232432975-232432997 GGGCCCCTGCAGCCACCGCCTGG - Intergenic
947742258 2:232490039-232490061 GGCACCCAGCTGCCTCACTCAGG - Intergenic
947765275 2:232633771-232633793 GGCCCCCAGCTGGCTCCCCTCGG + Exonic
948428741 2:237904908-237904930 GTCCCCCAGCTACCCCCGGCTGG - Intronic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
949042482 2:241855689-241855711 GGCCAGCAGGTTCCTCCGCCCGG - Intronic
1168750222 20:276901-276923 GGCCCCCAGGTGCCTCTTCCTGG + Intronic
1169327421 20:4686892-4686914 GGCCGCCAGCGGGCTCCGCAGGG + Intronic
1170460473 20:16573082-16573104 GGCCCCCAGAGGCCACAGCCTGG + Intronic
1171311923 20:24151490-24151512 GGCTCCCAGCTCCCTCCTGCTGG + Intergenic
1172613706 20:36269326-36269348 GGCCCCCAGCTGCCAGGACCAGG + Intronic
1173519975 20:43692135-43692157 GGCCCCCTGCTGCCCCCTGCAGG + Exonic
1173609387 20:44355679-44355701 TGCGGCCAGCTGCCACCGCCCGG - Intronic
1173815817 20:45987461-45987483 GGGCACCCGCTGCCTCCACCAGG + Intergenic
1175061741 20:56249608-56249630 GGCCCCCTTCTTCCTCCACCTGG + Exonic
1175213417 20:57375940-57375962 GGCCCCCCGCTATCTCAGCCTGG + Intronic
1175251873 20:57614861-57614883 GGCCCCCGGCTGCCTGTGTCTGG - Intronic
1175714667 20:61247384-61247406 GGGCCCCAGTTCCCTCAGCCTGG - Intergenic
1175856279 20:62122542-62122564 CGCCCGCCGCCGCCTCCGCCTGG - Exonic
1175923277 20:62459724-62459746 GGCTCCGGGCTGCCTCCTCCAGG - Intergenic
1175928594 20:62482677-62482699 CTCCCCCAGCTGCCTGGGCCAGG - Intergenic
1175931352 20:62495347-62495369 GGACCCCACATGCCTCCTCCCGG - Intergenic
1175947583 20:62565950-62565972 GGCCACCAGCTGCCGGCCCCAGG + Intronic
1175948057 20:62567905-62567927 CTGCCCCAGCTGCCTCCTCCTGG - Intronic
1176109725 20:63405809-63405831 GGGCTCCAGCTGCCTCGCCCTGG - Intergenic
1176138277 20:63534529-63534551 GGCAGCCAGTGGCCTCCGCCTGG + Intronic
1176173642 20:63707732-63707754 CGCCCCAAGCCGCCGCCGCCAGG + Intronic
1176296701 21:5076861-5076883 TGCCCACAGCTGCCCCCTCCAGG - Intergenic
1176663228 21:9660208-9660230 GGGCCTTAGCTGCCTCCGGCAGG + Intergenic
1176671055 21:9735755-9735777 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
1178872120 21:36385596-36385618 GGCCCCGCGCGGCCTCCTCCCGG + Intronic
1179730271 21:43363773-43363795 GGAGCCCACCTGCCTCCTCCAGG + Intergenic
1179801749 21:43814538-43814560 TGCTCCCAGCTCCCTCGGCCTGG + Intergenic
1179860348 21:44185260-44185282 TGCCCACAGCTGCCCCCTCCAGG + Intergenic
1179881344 21:44294464-44294486 GGCCCCCAGCCCCGCCCGCCTGG + Exonic
1179923671 21:44521177-44521199 GCCCCTGAGCTGCCTCCTCCGGG + Intronic
1179957279 21:44748730-44748752 GGCCACCAGCTGCGTTCACCAGG + Intergenic
1180696465 22:17754300-17754322 GGACCCCAGCAGGCACCGCCAGG + Intronic
1180871617 22:19150029-19150051 GGCCCCCAGAGGCGGCCGCCGGG - Exonic
1181441967 22:22941423-22941445 GGCCCCAAGCTCCCTCCTCAGGG + Intergenic
1181532826 22:23526734-23526756 GGAGCCCAGCCGCCTCAGCCAGG + Intergenic
1182353435 22:29711320-29711342 GGCCTCCAGCTGCCTCCTTCAGG - Intergenic
1182420649 22:30247068-30247090 GGACCCCTGCTGACTCGGCCAGG - Intergenic
1182459217 22:30472200-30472222 TCCTCCCAGCTGCCTCCTCCTGG - Intergenic
1182490578 22:30668721-30668743 AGCCCCCAGTTCCCTCTGCCTGG + Intronic
1184251100 22:43260797-43260819 TCACCCCAGCTGCCCCCGCCAGG - Intronic
1184493723 22:44825431-44825453 GGCTGCCAGCTGCCCCTGCCAGG + Intronic
1184691728 22:46120333-46120355 GTCCCCCTGCTGCCTGGGCCAGG + Intergenic
1184747582 22:46465191-46465213 GGCCCTCACCTGCCACCTCCAGG + Intronic
1184921694 22:47609875-47609897 AGCCCTCAGCTGCCTCCTGCAGG - Intergenic
1185042265 22:48511142-48511164 GATCCCCAGCGGCCTCCTCCAGG - Intronic
1185043138 22:48515864-48515886 GGCCCACTGCTGGCTCCCCCAGG + Intronic
1185229103 22:49670345-49670367 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
1185291097 22:50028255-50028277 AGCCTCCAGCTGCCTCCCGCTGG + Intronic
1185294870 22:50048215-50048237 GTCCCCCAGCCGCCCCCACCCGG + Intronic
950435906 3:12979974-12979996 GGCCTCCAGCTGCATGCCCCTGG - Intronic
950502244 3:13371969-13371991 GGCCCACACGTGCCTCCACCTGG + Exonic
951415456 3:22417169-22417191 GGGCCTCAGCTGCCTCCCCCCGG + Intergenic
953908929 3:46882307-46882329 GGCCTCCAGCGCCCCCCGCCCGG - Intronic
953981979 3:47417813-47417835 GGCCCCCAGCAGGCAGCGCCGGG - Exonic
955543755 3:60005390-60005412 GGCCCCCAGCCCCTTCTGCCTGG + Intronic
956479679 3:69661043-69661065 GGAGCCCAGCTGGCTTCGCCTGG - Intergenic
960596429 3:119412048-119412070 GTCCCCCGGCTGCCTCGCCCTGG + Intronic
961450420 3:126999969-126999991 TGCCCCCACCTGCTTCTGCCTGG - Intronic
961822081 3:129580346-129580368 GGCCCGCCGCTGACTCCGTCTGG - Intronic
962591057 3:136890141-136890163 GGGCCTCAGCTGCCTCCCCGTGG - Intronic
964376277 3:156051983-156052005 GGGCCTCAGCTGCCTCCCCACGG + Intronic
964518935 3:157543075-157543097 GGCCAACAGCTGCCTCCGCCTGG - Intergenic
966396340 3:179507585-179507607 TGCCTCCAGCTCCCTCTGCCTGG + Intergenic
966832087 3:184018157-184018179 GCCTCCCGGCTGCCTCCCCCAGG - Intergenic
966853213 3:184177076-184177098 GGGGCACAGCTGGCTCCGCCAGG - Intronic
968233396 3:197017132-197017154 GGCCCCCATCTGTGTCGGCCCGG + Exonic
968395333 4:231230-231252 GGCACCCAGCTGCTTCCGAGAGG - Intergenic
968541105 4:1168867-1168889 GGCACCCAGGAGGCTCCGCCAGG - Intronic
968755886 4:2416602-2416624 TGCCCCCATGTGCCTCTGCCGGG - Intronic
968871932 4:3246713-3246735 GGCACCCAGCTGCTCCTGCCTGG - Intronic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
968920170 4:3518415-3518437 GTGCCCCAGCTGTCACCGCCAGG - Intronic
968931488 4:3581788-3581810 CCCACCCAGCTGCCTCCTCCAGG + Intronic
969166629 4:5321804-5321826 TGCCCCCAACTGCCTCTGCCTGG + Intronic
969321167 4:6413745-6413767 TGACCCCAGCTGCCACCACCAGG - Intronic
970408632 4:15786878-15786900 GGGCCTCAGCTGCCTCCCCGCGG - Intronic
972173389 4:36375165-36375187 GGGCCTCAGCTGCCTCCCCACGG + Intergenic
972890488 4:43551431-43551453 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
976102508 4:81580668-81580690 GGGCCTCAGCTGCCTCCCCGTGG + Intronic
977206539 4:94170061-94170083 GGCCCTTAGCTGCCTCCCCATGG + Intergenic
979133968 4:117085421-117085443 GAGCCGCAGCTGCCTCCCCCTGG + Exonic
979609031 4:122670433-122670455 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
979949499 4:126874598-126874620 GGGCCTCAGCTGCCTCCCGCAGG - Intergenic
980930228 4:139177285-139177307 GGCCTCCTGCCGCCTCCACCAGG + Intergenic
981782379 4:148443721-148443743 GCCGCACAGCTGCCGCCGCCGGG - Intronic
982175828 4:152704655-152704677 GGCCCCCATTGGCCTCCGCGCGG - Intronic
982257667 4:153466322-153466344 GCGCCCCAGCTGCCTCGCCCCGG - Intergenic
983369692 4:166842758-166842780 GGAGCCCAGCTGGCTTCGCCTGG + Intronic
983369750 4:166842968-166842990 GGGCCTCAGCTGCCTCCCCGCGG - Intronic
984699080 4:182807105-182807127 GCTCCCCAGCCGCCTCGGCCTGG + Intergenic
985412095 4:189695844-189695866 GGGCCTTAGCTGCCTCCGGCAGG - Intergenic
985646088 5:1085422-1085444 CGCCACCTGCAGCCTCCGCCTGG + Exonic
987050426 5:14143612-14143634 AGCACCCAGCTGCCCGCGCCCGG - Intergenic
987218904 5:15769153-15769175 TGCCACCAGCTGCCTCCTTCTGG + Intronic
990512132 5:56498800-56498822 GGGCCTCAGCTGCCTCCCCACGG - Intergenic
992089330 5:73303523-73303545 GGCGCCCAGCTGGCTTCGCACGG + Intergenic
993202198 5:84830456-84830478 GGGCCTCAGCTGCCTCCCCGCGG - Intergenic
995073962 5:107959470-107959492 GTGCCCCACCTGCCTTCGCCTGG + Intronic
995529149 5:113075253-113075275 GGGCCTCAGCTGCCTCCCCGCGG + Intronic
996765510 5:127031000-127031022 GGCCCTCAGCTTCCTCCGGGCGG - Intergenic
997661833 5:135595099-135595121 GGGCTCCACCTGCCTCCACCAGG - Intergenic
1001972253 5:175966106-175966128 GGCTCCCTGCAGCCTCCACCTGG - Intronic
1002078834 5:176725930-176725952 TGCCCCCAGCCGCCTGCTCCTGG - Intergenic
1002245185 5:177877671-177877693 GGCTCCCTGCAGCCTCCACCTGG + Intergenic
1002616467 5:180459387-180459409 GGGCCTCAGCTGCCTCCCCGCGG + Intergenic
1003593789 6:7456761-7456783 GGAGCCCAGCTGCCTTCACCTGG - Intergenic
1004354093 6:14916201-14916223 GGGCCTCAGCTGCCTCCCCACGG + Intergenic
1005336569 6:24802574-24802596 TGCCTCCAGTTGCCTCTGCCTGG + Intronic
1005847038 6:29790035-29790057 GGCCCCCAACAGCCACCTCCCGG + Intergenic
1006372484 6:33653934-33653956 GGACCCCAGCTGCCTCCTGAGGG + Intronic
1006752517 6:36387589-36387611 GGGCCCCAGCAGCCACAGCCAGG - Exonic
1006850343 6:37093484-37093506 GGCCCCCACCTGCTCCAGCCAGG - Intergenic
1007305095 6:40897598-40897620 GGCCCACTGCTGCCTCTGCCTGG + Intergenic
1007479369 6:42140151-42140173 GGCCTCCAGCTGACTCAGCTTGG - Intronic
1008521225 6:52363114-52363136 GGTCCCCACCCGCCTCCGTCTGG - Intronic
1009615484 6:65999524-65999546 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic
1009746697 6:67825618-67825640 GGGCCTCAGCTGCCTCCCCACGG + Intergenic
1010032956 6:71289042-71289064 GGGCCCTCGCTGCCGCCGCCCGG - Exonic
1011410318 6:87059936-87059958 GGGCCTCAGCTGCCTCCTCATGG - Intergenic
1012017783 6:93874066-93874088 GGCCTCCAGCTGCCTCCATGTGG - Intergenic
1015732031 6:136358868-136358890 GGGCCCCAGCTGCGTAAGCCTGG + Intronic
1016104711 6:140148264-140148286 GGGCCTTAGCTGCCTCCCCCGGG - Intergenic
1017696989 6:157025994-157026016 GGCTCACTGCAGCCTCCGCCTGG + Intronic
1018478592 6:164167896-164167918 GGCCCACAGCTGCCTCACTCAGG - Intergenic
1018900044 6:168046474-168046496 GGACCCCAGCAGCCTGGGCCAGG - Intergenic
1019344503 7:522718-522740 AGCTCCCCGCTGCTTCCGCCAGG - Intergenic
1019356848 7:584744-584766 GCCCCCCACCTCCCTCCTCCCGG + Intronic
1019515933 7:1440170-1440192 GGCCACCTGCTCCCTCCGGCTGG - Intronic
1019564786 7:1673922-1673944 GACCCCCTCCTGCCTCAGCCTGG - Intergenic
1019604611 7:1902163-1902185 GCCCCACACCTGCCTCCTCCTGG + Intronic
1020097194 7:5375821-5375843 TGCTCACAGCTCCCTCCGCCTGG + Intronic
1020560763 7:9727217-9727239 GTCCACCAGCTGCCTCTGCACGG - Intergenic
1022100527 7:27166535-27166557 GGTCGCCAGCCGCCTGCGCCTGG - Intronic
1024318840 7:48045514-48045536 GGCCCCCAGCCACCTCCTTCAGG + Intronic
1024579915 7:50793235-50793257 GGCTCCCCGCCGCCTCCGCGTGG + Intronic
1024748118 7:52431160-52431182 AGAGCCCAGCTGGCTCCGCCTGG + Intergenic
1025129185 7:56366923-56366945 GGCCCCCAACGGCCTCCGGTCGG - Intergenic
1025188107 7:56876586-56876608 GTGCCCCAGCTGCCCCTGCCCGG - Intergenic
1025683816 7:63700336-63700358 GTGCCCCAGCTGCCCCTGCCCGG + Intergenic
1025806539 7:64838649-64838671 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1026045797 7:66904489-66904511 TGCCCCCAGGGGCCTACGCCAGG - Intergenic
1026516588 7:71078207-71078229 CGGCCTCAGCTGCCTCCGCGGGG + Intergenic
1026537489 7:71252013-71252035 GTGCCCCTGCTGCCTCCTCCGGG + Intronic
1029037936 7:97541428-97541450 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
1029457890 7:100680087-100680109 GGCCCCCACCTGCCTCTCCCTGG - Exonic
1029537252 7:101163905-101163927 GGCCTCCGCCTGCCGCCGCCCGG + Exonic
1031409224 7:121421947-121421969 GGCCCTTAGCTGCCTCCCCATGG + Intergenic
1031902885 7:127429389-127429411 GGGCCTCAGCTGCCTCCCCGTGG + Intronic
1032339665 7:131058981-131059003 GGGCCTCAGCTGCCTCCCCGCGG + Intergenic
1032437141 7:131909545-131909567 GGGCCTCAGCTGCCTCCCGCGGG + Intergenic
1032437203 7:131909766-131909788 GGAGCCCAGCTGGCTTCGCCTGG - Intergenic
1033742487 7:144285338-144285360 GGCCCCCAGTTGCCTTTCCCAGG - Intergenic
1033751415 7:144364276-144364298 GGCCCCCAGTTGCCTTTCCCAGG + Exonic
1034260068 7:149749672-149749694 GGGCCCCAGTTGGCTCCCCCAGG - Intergenic
1034405939 7:150902517-150902539 GGGCCCCAGCTGCCTGTGCTGGG - Intergenic
1034478480 7:151302432-151302454 GGCCCTCAGCTGCCACCACGAGG - Intergenic
1034516637 7:151585993-151586015 GTACCCCAGCTTCCTCCGCCAGG - Intronic
1034734068 7:153412643-153412665 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1034988715 7:155534029-155534051 GTCCCCCTGCTGGCCCCGCCGGG + Intergenic
1035090678 7:156307533-156307555 GGCCCCCTGCCTCCTCCGGCAGG - Intergenic
1035206225 7:157295535-157295557 GGCCCCCAGCAGCCAGTGCCAGG + Intergenic
1035266345 7:157692143-157692165 GGCCCCCCTCTCCCACCGCCTGG + Intronic
1035325431 7:158062789-158062811 GGGCCTCAGCTGCCTCCCCATGG + Intronic
1035444620 7:158931966-158931988 GGCCCCATTCTGCCTCCTCCCGG - Intronic
1035683556 8:1507298-1507320 GGGCCTCAGCTGCCTCCCCGTGG - Intronic
1036220115 8:6914417-6914439 TGCCCGCAGCTCCCTGCGCCCGG + Intergenic
1036617827 8:10402543-10402565 GGCTCCCAGCTGCCTCCAGTGGG - Intronic
1037239492 8:16760681-16760703 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic
1037817758 8:22120798-22120820 CGGCCCCGGCTGCCTCCCCCAGG - Exonic
1039921602 8:41897223-41897245 GGCCCTCAGCGGCCACCGCCCGG - Intergenic
1039964201 8:42271785-42271807 GATCCCCAGCTGACTCCACCAGG - Intronic
1040545773 8:48396943-48396965 GGCCCCCACATCCCTCTGCCTGG + Intergenic
1040583394 8:48716120-48716142 GGGCCTCAGCTGCCTCCCCACGG - Intronic
1042556224 8:70035412-70035434 GGTCCCCAGCAGCCTCCAACTGG - Intergenic
1042991186 8:74641903-74641925 GGCCCCCATCTTCCTCCCCTGGG - Intronic
1044858108 8:96495414-96495436 CGTCCGCAGCTGCCTCCACCTGG + Intronic
1044862131 8:96533952-96533974 GGACCTCAGCTGCCTCCCCGCGG - Intronic
1044963936 8:97557132-97557154 GGGCCTCAGCCGCCTCCGCAGGG + Intergenic
1045327282 8:101126650-101126672 CGCCCCCAGCCGCCCCCGCCCGG + Intergenic
1045950611 8:107847896-107847918 GGCCTCCAGCAGCATCTGCCAGG - Intergenic
1047898049 8:129388780-129388802 AGCCTCCAGCTGCCTCCCCAAGG - Intergenic
1048554100 8:135457977-135457999 GGCCCCCAACCGCCGCCGGCCGG - Intronic
1049082944 8:140457270-140457292 GCCTCCGAGCTGTCTCCGCCTGG - Intronic
1049288690 8:141790492-141790514 TCCCCCCAGCAGCCTCCTCCTGG - Intergenic
1049662691 8:143827213-143827235 GGCCCCCGGCTGCCATGGCCTGG - Intronic
1049775150 8:144400614-144400636 GCCCCCTAGCTGCCTCTGCCTGG - Intronic
1050892020 9:10836173-10836195 GGGCCTCAGCTGCCTCCCCACGG + Intergenic
1052014866 9:23452251-23452273 GGGCCTCAGCTGCCTCCCCGTGG + Intergenic
1052862935 9:33447744-33447766 TGCCCGCAGCTCCCTCCACCCGG - Intergenic
1053011704 9:34637420-34637442 GCCGCCCCTCTGCCTCCGCCAGG - Exonic
1053168647 9:35862502-35862524 AGCCCTCAAATGCCTCCGCCAGG - Intergenic
1053593295 9:39534299-39534321 GCCCCCCAGCCCCCTCCCCCAGG + Intergenic
1053851028 9:42289007-42289029 GCCCCCCAGCCCCCTCCCCCAGG + Intergenic
1054458641 9:65450141-65450163 CCCACCCAGCTGCCTCCTCCAGG - Intergenic
1054573011 9:66830978-66831000 GCCCCCCAGCCCCCTCCCCCAGG - Intergenic
1054788038 9:69228207-69228229 GGCCTCCAGCTGCATCCACGTGG - Intronic
1055654947 9:78442291-78442313 AGCCCTCAGCTGCCTCCCCGCGG + Intergenic
1056677232 9:88686058-88686080 GGGCCGCAGCTGCCTCCCCGCGG - Intergenic
1057075667 9:92136945-92136967 AGCCCCCAGCAGCCCCAGCCCGG - Intergenic
1058176131 9:101738171-101738193 CGCTCCCAGGTCCCTCCGCCTGG + Exonic
1058365197 9:104200812-104200834 GGGCCTCAGCTGCCTCCCCATGG + Intergenic
1058379555 9:104363043-104363065 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic
1059281261 9:113136046-113136068 TGACCCCATCTGCCTCAGCCTGG + Intergenic
1059432461 9:114258392-114258414 GGGCCCCAGCAGCCTCCACATGG - Intronic
1060305370 9:122406339-122406361 GGGCCTTAGCTGCCTCCCCCCGG - Intergenic
1060763642 9:126276609-126276631 GGTCTCCAGCTGCCTCCGCTCGG - Intergenic
1061042110 9:128146251-128146273 GGCACCCACCTGCCTCCCCTCGG - Intergenic
1061246336 9:129402860-129402882 TGCCCTCAGCAGCCTCCCCCTGG + Intergenic
1061498953 9:130991390-130991412 GTCCCCCAGGGGCCTCCACCAGG + Intergenic
1061739576 9:132691110-132691132 AGCCACCACCTGCCTCCCCCAGG + Exonic
1061884600 9:133585264-133585286 GGCCTCCACCTGCCTCCCCCGGG + Intronic
1062409163 9:136413619-136413641 GACTCCCAGCTGCCCCTGCCAGG + Intronic
1062466348 9:136683296-136683318 GCCTCCCAGCTGCCTGAGCCAGG - Intronic
1062472534 9:136712750-136712772 CGCCCCCGGCCGCCTCTGCCTGG + Intronic
1203774146 EBV:63378-63400 GGCCCCCACCTGCCTCGACCCGG - Intergenic
1203662871 Un_KI270753v1:61557-61579 GGGCCTTAGCTGCCTCCGGCAGG - Intergenic
1203670499 Un_KI270755v1:7137-7159 GGGCCTTAGCTGCCTCCGGCAGG + Intergenic
1186466025 X:9785650-9785672 GCCCCCCAGCAGCCTGAGCCGGG - Intronic
1186509780 X:10122058-10122080 GAGCCCCAGCTTCCTCCCCCGGG + Intronic
1187362499 X:18641500-18641522 GACCCTCAGCTGCCTCCCCAGGG + Exonic
1187464582 X:19515586-19515608 TGCCCCCTGCTGCCCCCTCCAGG + Intergenic
1189426887 X:40909819-40909841 GGCTCTCAGCTGCCTACCCCAGG - Intergenic
1190012435 X:46796772-46796794 GGCCCCCTGCTGCCACCTGCTGG + Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1190414446 X:50167267-50167289 GCCCCCTAGCTGCCTCTTCCTGG + Intergenic
1192056932 X:67782760-67782782 GGCCCTCAGCTGCCTGCCCCTGG - Intergenic
1193073479 X:77331995-77332017 GCACCCCAGCTGCCTCCTGCAGG - Intergenic
1194197660 X:90915072-90915094 GGGCCTCAGCTGCCTCCCCGTGG + Intergenic
1196860847 X:120025909-120025931 GGACCTCAGCTGCCTCCCCGCGG - Intergenic
1197722672 X:129755787-129755809 GCTGACCAGCTGCCTCCGCCTGG + Intronic
1198256155 X:134925861-134925883 GGGCCCCTGCTGCCTCCGGAGGG + Intergenic
1198705838 X:139447139-139447161 CGCGCCCAGCTGCATCCTCCTGG + Intergenic
1198832449 X:140764857-140764879 GGCTCCCGGCTTCCTCCTCCGGG + Intergenic
1199724552 X:150568280-150568302 GCTTCCCAGCCGCCTCCGCCCGG + Intergenic
1199744688 X:150764635-150764657 AGCCCCCCCCAGCCTCCGCCAGG - Exonic
1200544077 Y:4497741-4497763 GGGCCTCAGCTGCCTCCCCGTGG - Intergenic