ID: 1152637301

View in Genome Browser
Species Human (GRCh38)
Location 17:81435390-81435412
Sequence GGGCAGTGGGGGTCGCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152637301_1152637317 14 Left 1152637301 17:81435390-81435412 CCTCGGTGCGACCCCCACTGCCC 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1152637317 17:81435427-81435449 CACGCTCCACCAGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 90
1152637301_1152637312 5 Left 1152637301 17:81435390-81435412 CCTCGGTGCGACCCCCACTGCCC 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1152637312 17:81435418-81435440 GCTCTTCCCCACGCTCCACCAGG 0: 1
1: 0
2: 0
3: 27
4: 195
1152637301_1152637316 13 Left 1152637301 17:81435390-81435412 CCTCGGTGCGACCCCCACTGCCC 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1152637316 17:81435426-81435448 CCACGCTCCACCAGGCTCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152637301 Original CRISPR GGGCAGTGGGGGTCGCACCG AGG (reversed) Intronic
900120493 1:1046713-1046735 GGCCAGTGGGGGTGGCTCTGGGG + Exonic
900460917 1:2801811-2801833 GGGCAGTGTGGGTGGGACCTCGG - Intergenic
902482734 1:16720052-16720074 TGGCGGTGGGGATCCCACCGCGG - Intergenic
903215128 1:21839501-21839523 GGGCAGTGGGGAACGCAGCTTGG + Exonic
903332045 1:22601354-22601376 TGGCGGTGGGGGCCTCACCGTGG + Exonic
906639523 1:47433362-47433384 GGGCAGTGGGGGACGCTTCCAGG - Intergenic
912460687 1:109828882-109828904 GTGCAGTTGGGGTGGCAACGAGG - Intergenic
912675513 1:111676716-111676738 GGCCAGTGGTGGTGGCACAGGGG - Intronic
913058581 1:115184159-115184181 GGTCAATGGGAGTCGCCCCGTGG + Intergenic
915967843 1:160327470-160327492 GGGCTGGGGGGGGCGCAGCGCGG + Intronic
916470270 1:165117013-165117035 GTGCAGTGGGGGTCACAGGGAGG + Intergenic
920534547 1:206729139-206729161 GGGCAGTGGGGGTCTGAAGGGGG + Intronic
920850205 1:209623388-209623410 GGGGAGTGGGGTTCTCACAGGGG + Intronic
920958372 1:210640656-210640678 GGGCAGTGGGGGGCGGAGTGCGG - Intronic
922799253 1:228357204-228357226 GGACAGTGGGTGTGGCACTGGGG - Intronic
924242939 1:242057531-242057553 GGGCAGTGGGGGAAGGACGGGGG - Intergenic
1063458466 10:6201454-6201476 GGGGAGTGGGGGTCGAGGCGTGG + Intronic
1067561183 10:47305734-47305756 GGGCAGTGGGGATGGTACTGGGG - Intronic
1067972827 10:50991763-50991785 GCGGAGTGGGGGTGGCCCCGCGG + Intronic
1069161642 10:65100766-65100788 GGACAGTGGGGGTAGGACAGTGG + Intergenic
1070570488 10:77637077-77637099 GGGCAGCGGGCGGCGCGCCGGGG - Intronic
1072758754 10:98038663-98038685 GGGCTGTGGGCGCCGCAGCGTGG + Intergenic
1075705053 10:124495473-124495495 AGGCAGTGGAGGACGCACAGGGG + Intronic
1076143150 10:128095712-128095734 GCGCTGTGGGGGTGGCAGCGGGG + Intergenic
1076611202 10:131726970-131726992 GGGCAGTGCGGGCCGCAACAGGG - Intergenic
1077322084 11:1947110-1947132 GGGGAGTGGGGGTCGGGGCGGGG + Intergenic
1079092816 11:17492947-17492969 GGGCAGTGGGTGTGTCCCCGAGG + Intergenic
1079846301 11:25473718-25473740 GGGCGGGGGGTGTCGCACAGGGG - Intergenic
1080892342 11:36419905-36419927 GGGTAGTGGGGGTCCCCCAGGGG + Intronic
1084425339 11:69081167-69081189 GGGGGATGGGGGTCGCTCCGGGG + Intronic
1089362906 11:117902707-117902729 TGGCACTGGGGCTGGCACCGAGG + Intronic
1202805100 11_KI270721v1_random:2423-2445 GGGGAGTGGGGGTCGGGGCGGGG + Intergenic
1091600429 12:1914662-1914684 GGGCAGTGGGGGTGGTTCGGGGG - Intronic
1094174543 12:27528019-27528041 GGGAAGTGGAGGTTGCAGCGAGG - Intronic
1096241301 12:49961686-49961708 GGGGGGCGGGGGTCGCGCCGGGG + Intergenic
1096465760 12:51847244-51847266 GGTCAGAGGGTTTCGCACCGTGG + Intergenic
1097222649 12:57460077-57460099 GGGGGGTGGGGGTGGCATCGAGG + Intergenic
1102543351 12:113638043-113638065 GGGGAGTGGGGGGCGAGCCGGGG - Intergenic
1102908214 12:116693759-116693781 CGCCAGTGGGAGTCGCACGGGGG + Intergenic
1103348406 12:120265885-120265907 GGGCAGTGGGCGTCGCTGGGCGG + Intergenic
1103567281 12:121823072-121823094 GGGCAGCAGGGGTGGCAGCGGGG - Exonic
1104698105 12:130879833-130879855 GGAAAGGGAGGGTCGCACCGTGG + Intergenic
1105681899 13:22736663-22736685 GGGCTGTGGGGGTCACAGGGCGG - Intergenic
1106640998 13:31584489-31584511 GGACAGTGGGGGCCGGACAGTGG - Intergenic
1108363822 13:49691300-49691322 GGGCAGGGGGCGGCGGACCGCGG - Exonic
1108588488 13:51891851-51891873 GGGCAGTGGGGGTTGGAGGGGGG + Intergenic
1113797491 13:113066846-113066868 GGGCCGTGCGGGGCGCACCCAGG + Intronic
1113901776 13:113801821-113801843 GAGCAGCGGGGGTCCCACCAAGG - Intronic
1118896790 14:69952159-69952181 GAGCAGTGGAGGTTGCACTGTGG - Exonic
1122896040 14:104757517-104757539 GGGCAGGGGGGGCAGCACCAGGG + Intronic
1128139861 15:65291674-65291696 GGGGAGATGGGGTCTCACCGTGG - Intronic
1128742942 15:70096134-70096156 GGCCGGTGGGGGCCGCCCCGGGG - Intronic
1130352998 15:83107785-83107807 GCGCGGCGGGGGTCGCGCCGAGG + Intronic
1132207128 15:99993861-99993883 GGGCAGTGGGGATGGGACCTGGG + Intronic
1132470098 16:97789-97811 GGGCCATGGGGGTCTCACAGTGG - Intronic
1132480158 16:163288-163310 GGGCAGTGGGGAGGGGACCGTGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132853866 16:2036241-2036263 GGGCAGTGGCGGCACCACCGGGG + Intronic
1133268571 16:4599528-4599550 GGGCACCGGGGATGGCACCGGGG - Intronic
1137244216 16:46689387-46689409 GGGCAGTGGGGATCGCCCGGCGG + Intronic
1138781719 16:59796520-59796542 GGGCGGTGGGGGGCGCATGGGGG + Intergenic
1142215007 16:88825758-88825780 GGGGAGTGGGGGACGCAGCTGGG + Intronic
1142767238 17:2071737-2071759 GGGCGGGGGGGGTCACACCTGGG + Intronic
1143448744 17:7023365-7023387 GGGCACTGGGGGTCGAACCCAGG + Intronic
1145755401 17:27386405-27386427 GTGCTGTGGTGGGCGCACCGTGG + Intergenic
1146059493 17:29596930-29596952 GGGCTGTGGGGACCGCACCCTGG - Intronic
1146654403 17:34626671-34626693 GGGCCGTGGGTGGCGCAGCGGGG - Intronic
1147336668 17:39730417-39730439 GGGCAGTGGGGTCCGCATCGTGG - Exonic
1147343738 17:39772619-39772641 GAGCTGTGGGGGTGGCACTGGGG + Intronic
1147909586 17:43847404-43847426 GGGAGGTGGGGGTGGCGCCGGGG + Intronic
1150010031 17:61494833-61494855 TGGCAGTGGGGGGCGCTCAGAGG - Intergenic
1151309918 17:73286579-73286601 GGGCAGAGGGGGACGCAATGAGG + Exonic
1151584919 17:75003155-75003177 GGGTAGTGAGAGTCGCAGCGGGG - Intronic
1151781829 17:76251825-76251847 GGGCAGTAGGGCTGGCACCCAGG - Intergenic
1151886475 17:76925872-76925894 GGGCAGAGGGGGTGGCTCTGGGG + Intronic
1151990525 17:77571287-77571309 GGGCAGTGGGGGTGGGGCAGGGG - Intergenic
1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG + Intergenic
1152637301 17:81435390-81435412 GGGCAGTGGGGGTCGCACCGAGG - Intronic
1152690024 17:81713772-81713794 GGGCAGTGGGGCTCAGACCCCGG - Intronic
1152814482 17:82399349-82399371 GGGCAGCGAGGCTGGCACCGGGG - Intronic
1154171780 18:12057503-12057525 TGGCAGTGGTGGTGGCAGCGAGG - Intergenic
1160613877 18:80109500-80109522 GGGCAGGGGGCGTCGCCGCGCGG - Intronic
1160788595 19:912736-912758 GGGGAGTGGGGCGCGGACCGGGG + Intronic
1160870440 19:1275401-1275423 GGGCACTGTGGGTAGCGCCGGGG + Intergenic
1160991838 19:1863312-1863334 GGGCGGCGGGGGTGGCCCCGGGG + Exonic
1161036527 19:2088046-2088068 CTGCAGTGGGGGTCTCACCTGGG + Intronic
1161698649 19:5783683-5783705 GGGGGGTGGGGGTGGCAGCGGGG + Exonic
1163695490 19:18761388-18761410 GGGCTGTGGGGGATGCACTGGGG + Intronic
1166370234 19:42296202-42296224 GGGCAGCAGGGGTCACACTGAGG - Intergenic
1167148238 19:47695019-47695041 GGGCAGTGGGGGTCCCAGATGGG - Exonic
1167577487 19:50324833-50324855 GGGCAGTGGTGGTGCCACAGAGG + Intronic
1167662838 19:50806122-50806144 GGGCTGTGTGGGTCACAGCGAGG - Intergenic
1167894522 19:52570306-52570328 GTGGAGTGAAGGTCGCACCGCGG + Intronic
928097208 2:28412094-28412116 GCGCAGTGGGGGTGGCTCGGTGG + Exonic
928904885 2:36357288-36357310 GGGGGGTGGGGGTTGCACCTGGG + Intronic
929583646 2:43100669-43100691 GTGCAGTGGGGGGCGTCCCGGGG - Intergenic
929687562 2:44047651-44047673 GGGCATTGGGGGTGGGAGCGTGG - Intergenic
934321375 2:91974715-91974737 GGGCAGTGAGGGTCGCCGCGGGG + Intergenic
936270142 2:111042911-111042933 TGGCAGTGGGGGTCGAAAGGAGG + Intronic
936970699 2:118173768-118173790 GGGCAGTGTGGGTGGCACCATGG + Intergenic
938064973 2:128276978-128277000 GGGCAGTGGGGGTTGCCCTGAGG + Intronic
938406102 2:131034156-131034178 GGGCAGGGAGGGGCGCACAGAGG - Intronic
948505914 2:238426961-238426983 GGGCAATGGGGGGCGCGTCGGGG - Exonic
948564023 2:238872124-238872146 GGGCTGGGGGGGTCCCACAGTGG + Intronic
948860651 2:240751116-240751138 GGGCAGGCTGGGCCGCACCGTGG - Intronic
1171457217 20:25278876-25278898 GGACAGTCGGGCTCGCACTGTGG - Intronic
1174139423 20:48402727-48402749 GGGCAGTGGGGGTGGAAACTAGG - Intergenic
1174199789 20:48799326-48799348 GGGCAGTGGGGATCTCACTTGGG - Intronic
1174390860 20:50217576-50217598 GGGCAGTGGGAGGGGCACAGGGG - Intergenic
1175314785 20:58039728-58039750 GGGGAGTGTGGGCCGCACAGGGG + Intergenic
1176040669 20:63064278-63064300 GGTCAGTGGGGGCCGTGCCGAGG - Intergenic
1176056321 20:63151047-63151069 TGGCAGAGTGGGCCGCACCGAGG + Intergenic
1176108541 20:63400797-63400819 GGGCAGGAGGGGTCTCACGGAGG - Intergenic
1176259137 20:64170020-64170042 GGGCAGTGAGGGTCATACTGTGG - Intronic
1178424361 21:32467565-32467587 GGGCAGTGGGGATGGCCCTGTGG - Intronic
1179809921 21:43864460-43864482 CGGGGGTGGGGGTCGCCCCGGGG - Intergenic
1181429316 22:22868327-22868349 GGGCAGTGCTGGTGCCACCGAGG - Intronic
1181987537 22:26810945-26810967 GGGCAGTGGGGGCCCCATGGAGG - Intergenic
1182141997 22:27967626-27967648 GGGCAGTGGTGGTGGCAATGGGG - Intergenic
1183541453 22:38431481-38431503 GGGCTGTCGGGGAGGCACCGGGG - Intronic
1183932833 22:41246016-41246038 GGACTGTGGGGGTCGGATCGTGG - Exonic
1185044227 22:48520885-48520907 GGCCAGGGGGGGTCGCAGGGTGG + Intronic
1185062586 22:48614836-48614858 AGGCACTGGGGGTGGCACTGGGG + Intronic
949719667 3:6974236-6974258 GGCCAGTGGGGGTAGCAACTGGG + Intronic
950125202 3:10506257-10506279 GGGCAGGTGGGGTCGCACACAGG - Intronic
955363551 3:58293101-58293123 GGGCAGTGGGGGTGGCATGGTGG - Intronic
956467047 3:69529527-69529549 GGGCAGTGTGGGCAGCACAGTGG - Intronic
962318816 3:134374708-134374730 GGGCAGGGGCGGACACACCGCGG - Intronic
967039030 3:185672558-185672580 GGGCAGCGGGGGGAGCTCCGCGG + Exonic
968333460 3:197892327-197892349 GGGCTGTGTGGGTAGCACCTTGG + Intronic
968914142 4:3489786-3489808 GGGCAGTGGAGGTAGGGCCGGGG + Exonic
968992184 4:3921891-3921913 GGGCAGTGGGGATGGCCCTGTGG + Intergenic
969353051 4:6609306-6609328 GGGCTGTGGGGGTCACCCCAGGG - Intronic
985118538 4:186616269-186616291 GGGCAGTGGCGGTCGTTCCAAGG - Intronic
985412102 4:189695896-189695918 GGGCAGTGGGCTTAGCACCTGGG - Intergenic
985542620 5:493879-493901 GGGCAGCGGGGGTTGGCCCGGGG + Intronic
987370455 5:17188070-17188092 GGGCAGAGGGAGTCCGACCGAGG + Intronic
989988744 5:50735858-50735880 GGGCAGTGGGGGTGGAAGCTGGG + Intronic
994871887 5:105362239-105362261 GGGCGGTGGTGGTTGCACTGTGG - Intergenic
996434836 5:123423075-123423097 GGGCAGTGGGGGTCCCGCCGGGG - Exonic
1000185718 5:158855873-158855895 GGGCAGGGGGTGTCCCACCATGG - Intronic
1001305884 5:170572369-170572391 GGGTATTGGAGGTCCCACCGGGG - Intronic
1002848378 6:968858-968880 TGGCAGAGGGGGAAGCACCGGGG + Intergenic
1010141796 6:72621819-72621841 GGGGAGTGCGGGGCGCTCCGAGG - Exonic
1011285095 6:85714825-85714847 GGGTAGTGGGGGTTGCAGGGGGG - Intergenic
1011607331 6:89117982-89118004 GAGGGGTGGGGGTCGCGCCGGGG - Exonic
1013075461 6:106766755-106766777 GGGCAGTGAGGGTGCCTCCGAGG + Intergenic
1016374490 6:143406479-143406501 GGGCAGTGGGGGTTGGAAGGAGG + Intergenic
1016472004 6:144384467-144384489 GGGCAGTGGGGGAGGCAGTGGGG - Intronic
1018968441 6:168507588-168507610 CAGCAGTGGGGGGCGCCCCGGGG - Intronic
1019029012 6:168994553-168994575 GGGGAGTGGGGGGCGCAGGGGGG + Intergenic
1019257149 7:59705-59727 GGGCAGTGGAGGTCGTACTGTGG + Intergenic
1019438548 7:1034541-1034563 GGGCAGTGGGAGACACACAGAGG + Intronic
1019774422 7:2903993-2904015 GGGGAGTGGGGTTGGCACCCCGG - Intergenic
1024116992 7:46204109-46204131 GGGCAGTGGGGGCTGCACGAAGG - Intergenic
1026017508 7:66682570-66682592 GGGAAGTGGGAGCCGGACCGAGG - Intronic
1029332372 7:99869553-99869575 GGGCGGTGGGGGTGGCAGTGAGG - Intergenic
1029424395 7:100487052-100487074 GGCCAGTGGGGGCCTCACAGAGG + Exonic
1029472585 7:100763927-100763949 GGGCAGGCAGGGTCGCACAGGGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032193849 7:129779045-129779067 GGGCAGTGAGGGTGTCACCCGGG - Intergenic
1034497758 7:151432423-151432445 GGGCACTGGGGAAGGCACCGTGG - Intronic
1036788996 8:11705168-11705190 GGGCAGCGCGGCCCGCACCGTGG + Intronic
1038160347 8:25031292-25031314 GGGCAGTGGGTGCAGCACTGGGG - Intergenic
1039331182 8:36538820-36538842 GGGCTGTGGGGGTTGCAGGGGGG - Intergenic
1040708221 8:50154429-50154451 GGACAGTGGGGGTAGGACAGTGG - Intronic
1042241412 8:66667621-66667643 TGGCAGTGGGAGTCGAAGCGAGG + Exonic
1047198194 8:122740650-122740672 GGGCAGTGGGTCTTGCACAGGGG - Intergenic
1049258174 8:141624917-141624939 GGGCAGTGAGGGTGGGACCTCGG - Intergenic
1049765673 8:144354205-144354227 GGGCGGTGGGGGTCGGGCCCAGG + Intronic
1049798073 8:144505569-144505591 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798091 8:144505611-144505633 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798109 8:144505653-144505675 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798125 8:144505695-144505717 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049801280 8:144518424-144518446 GGGGAGGGGGCGTCGCACGGAGG + Intronic
1050986576 9:12091056-12091078 TGGCAGTGGGGGTCACAGCTGGG + Intergenic
1051340665 9:16106906-16106928 GGGCAGTGAGGGTGGCTCCAGGG - Intergenic
1052878348 9:33584229-33584251 GGGCAGTGGGGGTTGGAAGGTGG + Intergenic
1053914061 9:42931890-42931912 GGGCAGTGGGGGTTGGAAGGTGG + Intergenic
1056709265 9:88977463-88977485 GGGCAGTGGTGTAGGCACCGAGG + Intergenic
1060995936 9:127874935-127874957 GGACAGTGAGGATGGCACCGAGG + Intronic
1061123117 9:128656483-128656505 GGGAAGGCGGGGTCGCAGCGCGG - Intronic
1061332178 9:129901837-129901859 GGGAAGTGGAGGTCACACTGAGG + Intronic
1061487008 9:130925114-130925136 GGGGAGTGGGGGTGGGACGGGGG - Intronic
1062630887 9:137462591-137462613 GGGGAGTGGGGGTCGCTCCTGGG - Intronic
1203670492 Un_KI270755v1:7085-7107 GGGCAGTGGGCTTAGCACCTGGG + Intergenic
1187154720 X:16712337-16712359 GCGCGGTGGTGGTAGCACCGGGG + Intronic
1190686119 X:52875404-52875426 GGGCAGTGGGGGAGGCAGGGTGG + Intergenic
1190699452 X:52975982-52976004 GGGCAGTGGGGGAGGCAGGGTGG - Intronic
1191138407 X:57090998-57091020 GGACAGTGGGGGTAGGACAGTGG - Intergenic
1191656776 X:63607151-63607173 GGGCAGTGGGGGCAGGACAGTGG + Intergenic
1192149232 X:68701663-68701685 GGGCAGTGGGGGTGGCAGTGTGG + Intronic
1192149239 X:68701684-68701706 GGGCAGTGGGGGTGGCAGTGTGG + Intronic
1195923156 X:110002572-110002594 AGGCAGTGGCGGTGGCAGCGGGG + Intergenic
1197119376 X:122871932-122871954 GGGCAGTGGGGGTGGCACTAGGG + Intergenic
1200358583 X:155578226-155578248 GGGCAGTGGTGGCTGCACTGTGG - Intronic