ID: 1152637622

View in Genome Browser
Species Human (GRCh38)
Location 17:81436576-81436598
Sequence GGCGGGGGTAGGGGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1851
Summary {0: 1, 1: 0, 2: 15, 3: 194, 4: 1641}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152637622_1152637643 26 Left 1152637622 17:81436576-81436598 CCTGCCACTCCCCTACCCCCGCC 0: 1
1: 0
2: 15
3: 194
4: 1641
Right 1152637643 17:81436625-81436647 CAGCTTTGGTCGAATCTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1152637622_1152637637 12 Left 1152637622 17:81436576-81436598 CCTGCCACTCCCCTACCCCCGCC 0: 1
1: 0
2: 15
3: 194
4: 1641
Right 1152637637 17:81436611-81436633 CACCCCGTCCCTCTCAGCTTTGG 0: 1
1: 0
2: 1
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152637622 Original CRISPR GGCGGGGGTAGGGGAGTGGC AGG (reversed) Intronic
900100679 1:960808-960830 GGCGGGGGTCGGGGCGCGGGGGG + Intronic
900113620 1:1019820-1019842 GGCGGGGAGAGGAGAGTGGGGGG - Intergenic
900127426 1:1074701-1074723 GGTGTGGGCAGGGAAGTGGCAGG - Intergenic
900147931 1:1166523-1166545 GGTGGGGGTGGGGGTGTGGGTGG - Intergenic
900204697 1:1427009-1427031 GGCGGGGAGAGGGGAGGGGGCGG - Intronic
900284230 1:1891421-1891443 GGCGGGGGTGGGGTAACGGCGGG + Intergenic
900363580 1:2301462-2301484 GGTGGGGCCAGGGGAGGGGCAGG - Intronic
900365347 1:2309816-2309838 GGAGGGGGTGGGGGGGGGGCCGG - Exonic
900380040 1:2379359-2379381 GGCGCTGGTTGGGGTGTGGCTGG + Intronic
900404408 1:2486148-2486170 GGCCTGGATAGGGGATTGGCAGG + Intronic
900467016 1:2830851-2830873 GGCGGGGGCGGGGGCGGGGCAGG - Intergenic
900471362 1:2856602-2856624 GGCTGGGGATGGGGACTGGCTGG + Intergenic
900579104 1:3399571-3399593 GGCTGGGGTTGGGGAGCAGCAGG + Intronic
900607800 1:3531508-3531530 GGCGGGGCTCGGGGCGGGGCCGG - Intronic
900785150 1:4644548-4644570 GGCGAGGGTGGGGGAATGGCAGG + Intergenic
900813233 1:4824124-4824146 GGCAGGGGTAGGGGATGGGGAGG + Intergenic
901016758 1:6236162-6236184 GGCGGGGGCCGGGAAGTGGTGGG + Intergenic
901045524 1:6393500-6393522 GGCGGGGCTCGGGGTGGGGCCGG - Intronic
901066761 1:6497967-6497989 GGCGGGGGCTGGGGACTGGGTGG - Intronic
901433875 1:9234712-9234734 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
901480195 1:9519824-9519846 GGCTGGGGAAGGAGAGCGGCCGG + Intergenic
901843245 1:11966492-11966514 GGCGGCGGGATGGGAGTGGGGGG + Intronic
901915350 1:12495296-12495318 GGGGTGGGCGGGGGAGTGGCGGG - Intronic
902402892 1:16167645-16167667 GGGCGGGGTGGGGGAGTGGGTGG + Intergenic
902430510 1:16359483-16359505 GGCTGAGGTAGGAGAATGGCCGG - Intronic
902451508 1:16499362-16499384 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
902468175 1:16630802-16630824 GGTGGGGGTGGGGGCGTGTCTGG - Intergenic
902606960 1:17574123-17574145 AGGGGGAGTAGGGGAGTGGGTGG - Intronic
902701423 1:18175072-18175094 GAGGTGGGTAGGGGAGAGGCTGG - Intronic
902776201 1:18676486-18676508 GGCTGGGGGAGGGGAGGGGAGGG + Intronic
902798650 1:18815869-18815891 GCTGGGGGTGGGGGACTGGCGGG - Intergenic
902802947 1:18841678-18841700 GGCAGGGGCAGGGCAGGGGCAGG + Intronic
902837827 1:19058199-19058221 GGGAGGGGGAGGGGAGGGGCAGG + Intergenic
902919173 1:19656392-19656414 GGCGGGGATAGGGGGGTGGGTGG + Intronic
902954742 1:19917795-19917817 GGTGGGGGTGGGTGAGTAGCAGG + Intergenic
902977494 1:20099377-20099399 AGAGGGGGCGGGGGAGTGGCGGG + Intergenic
903065535 1:20697202-20697224 GGAGGTGGTAGGTGAGTGGCAGG + Intronic
903213397 1:21830718-21830740 GCTGGGGGTGGGGGAGTGCCTGG + Intronic
903373895 1:22853866-22853888 GGCAGGGGTGGGGGCCTGGCTGG + Intronic
903454757 1:23479726-23479748 AGTGGGGGAATGGGAGTGGCTGG - Intronic
903467149 1:23559569-23559591 GGCGGGGGCAGGGCCGAGGCGGG - Exonic
903647743 1:24905048-24905070 GGCTGGGGTATGGGAGGTGCTGG + Intronic
903694321 1:25196028-25196050 AGTGGGGGCAGGGGAGGGGCAGG + Intergenic
903967926 1:27101520-27101542 GCCTGGGTTAGGGCAGTGGCAGG - Intronic
904014643 1:27410051-27410073 GGCGGAGGTGGCGGAGGGGCAGG + Exonic
904378557 1:30096477-30096499 GGGGTGGGGAGGGGAGAGGCAGG + Intergenic
904381068 1:30111550-30111572 GCCGTGGGGAGGGGAGTGGCGGG + Intergenic
904591626 1:31618232-31618254 TGCGGGAGGAGGGGAGGGGCGGG + Intronic
904680042 1:32222644-32222666 GGAGGGGGTCCGGGAGGGGCGGG + Intronic
904686809 1:32266671-32266693 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
904686832 1:32266713-32266735 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
904686857 1:32266760-32266782 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
904686883 1:32266808-32266830 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
904753281 1:32754186-32754208 GGCCGGGGTGGGGGCGGGGCAGG + Intronic
904858334 1:33516614-33516636 GGCAGTGGGAGGGGAGGGGCCGG + Intronic
904944239 1:34187763-34187785 GGCGGGGGGGGGGGGGTGGGTGG - Intronic
905140769 1:35842312-35842334 GATGAGGGTAGGGGAGCGGCGGG - Intronic
905273148 1:36800219-36800241 AGAGGTGGGAGGGGAGTGGCTGG + Exonic
905454175 1:38076200-38076222 GGAGGGGGGAGGGGAGGGACAGG - Intergenic
905505589 1:38476590-38476612 GGCGCGGGGAGCGGAGGGGCAGG - Intergenic
905507323 1:38490244-38490266 GGCGGGGGGAGGGCAGGGGTGGG - Intergenic
905743163 1:40389906-40389928 GGGCGGGGGAGGGGAGTGGGTGG - Intronic
905751026 1:40464123-40464145 GTCGGGGGTGGGGGAGGGGCAGG - Intergenic
905786472 1:40761907-40761929 GGCGGGGGTGTGGGCGTGGGTGG - Intronic
905862606 1:41361405-41361427 GGCGGGGGACGGGGAGGGGGCGG - Intergenic
905891517 1:41521383-41521405 GGCGGGGGCAGAGGAGAGGGAGG - Intronic
905995158 1:42375168-42375190 GGCTGGGGTGGGTGAGTGGGTGG + Intergenic
906062764 1:42959003-42959025 GAGGGGGTGAGGGGAGTGGCCGG + Intergenic
906187288 1:43871556-43871578 GGCTGGGGTATGGGAGAGGATGG + Intronic
906525366 1:46490428-46490450 GGCGCGGGGAGGGAGGTGGCCGG + Intergenic
906543196 1:46603974-46603996 GCCTGGGGTCGGGGCGTGGCCGG - Intronic
906609573 1:47192252-47192274 AGCGGGGGTAGGGGTGTTGAGGG + Intergenic
906660477 1:47578213-47578235 GGCGAGGGTGGGGCAGGGGCTGG - Intergenic
906709058 1:47915850-47915872 GGTGGGGGTAGGGGAGCGTGGGG - Intronic
906768140 1:48455481-48455503 GGCTGAGGTAGGAGAATGGCGGG - Intronic
906802556 1:48750463-48750485 GGCTGGGGTAGGAGAGTTGTGGG - Intronic
906836943 1:49094216-49094238 GGTGGGGGTAGGGGAGTGGGGGG - Intronic
907270446 1:53287978-53288000 GACGGGGGTGGGGGTGGGGCAGG + Intronic
907288176 1:53395617-53395639 GCCGGGGGTTGGGGGGAGGCTGG - Intergenic
907328783 1:53658052-53658074 GGGGTGGATAGGGGAGTGGTGGG - Intronic
907401239 1:54226178-54226200 GGTGGGGGCAGAGGAGGGGCTGG + Intronic
907737090 1:57124929-57124951 GGCCGGGGTTGGGGGGTGGGAGG - Intronic
907798296 1:57739465-57739487 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
908148056 1:61268396-61268418 GGTGGGGGCAGGGGAGTAGAGGG - Intronic
908683441 1:66688097-66688119 GGAGGTGGTAAGGGGGTGGCAGG + Intronic
908695255 1:66832526-66832548 GTTGGGGGTAGGGCAGTGGTGGG + Intronic
908929993 1:69306464-69306486 GGAGGGGGCAGGGGAGTGCTGGG - Intergenic
909198542 1:72658543-72658565 GGAGAGGGTAGGGGAGCGGAGGG - Intergenic
909318004 1:74247990-74248012 CACGGGGGTAGGGGGGTGGAGGG + Intronic
909653603 1:78004188-78004210 GACGGGGGTTGAGGGGTGGCAGG + Intronic
910160586 1:84268147-84268169 GGTGGGGGTAGGGGGGTGGGTGG - Intergenic
910449421 1:87331060-87331082 GGCGGGGGGGGGGGGGGGGCGGG - Intronic
910449533 1:87331564-87331586 GGCGGGGGCTGGGGAGGGGCCGG + Intronic
910508401 1:87976810-87976832 GGTGGGGGAAGGGGGGTAGCAGG - Intergenic
910981237 1:92961535-92961557 GGCGGGGGCGGGGGAGTGGGCGG - Intergenic
911085478 1:93973942-93973964 AGCGGGGGGAGGGGGGTGGGAGG + Intergenic
911140505 1:94496598-94496620 GGTAGGGGTAGGGTAGTGGCAGG - Intronic
911166252 1:94727220-94727242 GGCGGGGGTGGGGATGAGGCTGG - Intergenic
912023438 1:105137731-105137753 TGCGGGGGTGAGGGGGTGGCAGG - Intergenic
912111562 1:106348859-106348881 GGTGGGAAGAGGGGAGTGGCGGG + Intergenic
912429343 1:109620889-109620911 GGCGGGGGGCGGGGAGGGGGTGG - Exonic
912733814 1:112132747-112132769 GGAGGGGGAAGGGAAGTGGAAGG - Intergenic
912963735 1:114218660-114218682 GGCTGGGATGGGGGAGAGGCTGG + Intergenic
913154375 1:116080503-116080525 GGCAGGAGAAGGGGAGTGGTTGG + Intergenic
913200069 1:116488701-116488723 GGTGGGGGTGGGGGTGTGGAGGG + Intergenic
913500436 1:119468139-119468161 GGTGGGGGTGGGGGGGGGGCGGG - Intergenic
913963063 1:143354037-143354059 GGCGGGCGTCGGGAAGTGACAGG + Intergenic
914057418 1:144179622-144179644 GGCGGGCGTCGGGAAGTGACAGG + Intergenic
914121728 1:144786744-144786766 GGCGGGCGTCGGGAAGTGACAGG - Intergenic
914302280 1:146387345-146387367 GGGGGTGGTTGGGGATTGGCTGG + Intergenic
914443567 1:147728993-147729015 GGCGGGGGTTGGGGAGTAGGGGG - Intergenic
914490731 1:148148856-148148878 GGCGGGGGTAAGGGAGGCCCTGG - Intronic
914921127 1:151848067-151848089 GGCTGGGGAAGGAGAGTGGCAGG + Intronic
915163161 1:153933588-153933610 GCGGGAGGCAGGGGAGTGGCGGG + Exonic
915218146 1:154353419-154353441 GGTGGGAGGAGGGGAGGGGCGGG - Intergenic
915253676 1:154608830-154608852 GGGGGGGGGAGGGGATGGGCGGG + Intronic
915339308 1:155167554-155167576 GGAGGGGGGAAGGGAGTGGCGGG - Intergenic
915495414 1:156279214-156279236 GGCGGGGGGTGGGGAGGGGCAGG - Intronic
915516060 1:156413344-156413366 GGCTGTGGTAGGTGAGGGGCAGG + Intronic
915553793 1:156650048-156650070 GGCTGGGGTTGGGGAGGGGTGGG + Intronic
915555848 1:156660245-156660267 GGGAGGGGAAGGGGGGTGGCTGG + Intergenic
915570857 1:156744443-156744465 GGTGGGGGTGGGGGAGAGGCGGG - Intronic
915574761 1:156768074-156768096 GGCGGGAGTTGGGGAGGGACTGG + Exonic
915585077 1:156840113-156840135 GGCAGGGGTGGGGGCGGGGCTGG + Exonic
915747723 1:158177732-158177754 GTCGGGGGTGGGGGGGTCGCGGG - Intergenic
915946240 1:160153928-160153950 GGCAGAGGTTGGGGAGTGGCTGG + Intronic
915953448 1:160205299-160205321 GGCGGGGGGCGGGGAATGGCGGG - Intergenic
916779430 1:168008878-168008900 GGAGGGGGGAGGGGAGGGGGTGG - Intronic
916793690 1:168146185-168146207 GGGGTGGGGAGGGGAGGGGCGGG + Intergenic
916842571 1:168615063-168615085 GGCTTGGGTAGGGCAGTGGAGGG + Intergenic
917126567 1:171693746-171693768 GGCGGCGGCAGGGCAGAGGCTGG + Intergenic
917345269 1:174022443-174022465 GGCGGGCGGAGGGGAGGGGCGGG + Intergenic
918040952 1:180913327-180913349 GGCGGGGGTGGCGGACCGGCGGG + Intronic
918389825 1:184047716-184047738 GGCAGGGGTCGGGGAGGGGGGGG - Intergenic
918789992 1:188813284-188813306 GGCGGGGGTGGGGGTGGGGATGG - Intergenic
918881125 1:190122578-190122600 GGTGGGGGTGGGGGAGGGGGAGG + Intronic
918881629 1:190131178-190131200 GGCGGGGGGTGGGGGGTGGGGGG + Intronic
918984962 1:191613599-191613621 GGAGTGGGTTGGGGAGTGCCAGG + Intergenic
919419626 1:197354836-197354858 GGCGGGGGGGGGGGGGTGGGCGG - Intronic
920024443 1:202982974-202982996 GGAGAGGGATGGGGAGTGGCTGG + Intergenic
920098170 1:203500014-203500036 GGCGGTGGTAGGTGGGTGGTAGG - Intronic
920190608 1:204191346-204191368 GGCGGGGTTGGGGGGGTGGGTGG - Intronic
920382107 1:205541142-205541164 GGCTGAGGAAGGGGAGTGGAGGG - Intergenic
920695672 1:208179865-208179887 GGCAGGGGTTGGGGGGTGGCAGG - Intronic
920839176 1:209539486-209539508 GTGTGAGGTAGGGGAGTGGCAGG - Intergenic
920907425 1:210184755-210184777 GGCGGGGGGTGGGGAGGGGGTGG - Intergenic
921101572 1:211933376-211933398 AGAGGGGGCAGGGGAGTGCCAGG - Intergenic
921218717 1:212958295-212958317 GCTGGGGGCAGGGCAGTGGCGGG - Intronic
921389806 1:214606363-214606385 GGCGGAGGTAGGGGAGGCCCTGG + Intronic
921925247 1:220705713-220705735 GGCAGGGAGAGGGCAGTGGCGGG + Intergenic
922234092 1:223710449-223710471 GGCGGGGGTAGGGGAGGGGGAGG - Intronic
922669010 1:227494892-227494914 GGTGGGGATAGGAGAGGGGCTGG - Intergenic
922670587 1:227506410-227506432 GGTGGGGATAGGAGAGGGGCTGG + Intergenic
922741290 1:228015700-228015722 GGCGGGGGTGGGGGGGAGGCGGG - Intronic
922934274 1:229411476-229411498 GGAGGGGGGAGGGGAGAGGGAGG - Intergenic
923003036 1:230023252-230023274 GGTGGAGGAAGGGGAGGGGCTGG + Intergenic
923092774 1:230752587-230752609 GGCTGGGGGAGGGGAGGGGCAGG + Intronic
923093091 1:230754107-230754129 GGCTGGGGGAGGGGCGGGGCAGG + Intronic
923093608 1:230757783-230757805 GGTGGGGGTAGGGGTGGAGCTGG + Intronic
923165285 1:231355705-231355727 AGAGGGGGAAGGGTAGTGGCAGG + Intergenic
923230679 1:231983552-231983574 GGGGGAGGTAGAGGAGTGGCAGG + Intronic
923309859 1:232725343-232725365 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
923309918 1:232725430-232725452 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
923739980 1:236646256-236646278 GGGGTGGGTGGGGCAGTGGCTGG - Intergenic
923871889 1:238004044-238004066 GTCGGGGGTAGGGGAGGGATAGG + Intergenic
924051104 1:240080399-240080421 GGAGGGGGTTGGGGAATGGGTGG - Intronic
924436567 1:244048625-244048647 GGCGGGGGCGGGGGGGGGGCGGG - Intergenic
924566815 1:245205842-245205864 GGTGGGGGTGGGGGTGTGGGTGG - Intronic
924651627 1:245933930-245933952 GGAGGGGGCTGGGAAGTGGCTGG - Intronic
924820736 1:247487797-247487819 GGCGGGGGGGGGGCGGTGGCCGG + Intergenic
1062764242 10:48965-48987 GGTGGGGGTGGGAGAGCGGCTGG - Intronic
1062874119 10:931565-931587 GCCGGAGGTAGGGGAGAGGGCGG + Exonic
1063232418 10:4078261-4078283 GGTGGGGGGAGGGGAGGGGAGGG + Intergenic
1063241538 10:4174666-4174688 GGCTGAGGTGGGAGAGTGGCTGG + Intergenic
1063357222 10:5412662-5412684 GGAGGGGGTGGGGCGGTGGCCGG - Exonic
1063393061 10:5662533-5662555 GGGGGGGGGAGGGGAGGGGAGGG + Intronic
1063434263 10:6017970-6017992 GGAGGGGGTAGGGGGGAGGCAGG + Intronic
1063599310 10:7465502-7465524 GTCGGGGGTGGGGGGTTGGCAGG + Intergenic
1064032622 10:11892859-11892881 GGCGGAGGCAGGAGAATGGCGGG - Intergenic
1064059669 10:12127554-12127576 GGCGGGGGGTGGGGGGGGGCAGG - Intergenic
1064120141 10:12611375-12611397 GGCGAGGGTAGAGGAGCTGCAGG - Intronic
1064167873 10:13001801-13001823 GGCGTGGGCGGGGGAGGGGCGGG + Intronic
1064357120 10:14629611-14629633 GGCTGGGGCAGGAGAATGGCTGG - Intronic
1064589057 10:16869549-16869571 GGTGGGGGTGGGGGGGGGGCGGG + Intronic
1064696450 10:17971255-17971277 GGGGAGGGGAGGGGAGGGGCAGG - Intronic
1064720882 10:18227335-18227357 GGTGTGGGCTGGGGAGTGGCTGG + Intronic
1065023591 10:21520481-21520503 AGCTGGGGGAGGGGAATGGCGGG - Intronic
1066115413 10:32234291-32234313 GGAGGGGGAAGGGGAGGGGGAGG + Intergenic
1066198956 10:33127944-33127966 GCGGGGGGGAGGGGAGGGGCGGG - Intergenic
1066672228 10:37852474-37852496 GGCTGGGGTTGGGGAATGACAGG + Intronic
1067038154 10:42934060-42934082 AGGGGGGGTAGGGGAGTGAATGG - Intergenic
1067060789 10:43077017-43077039 GGAGCGGGTAGGGGCGGGGCGGG - Exonic
1067270305 10:44785818-44785840 GGGAGGGGTAGGGGTGAGGCTGG + Intergenic
1067354999 10:45516049-45516071 GGATGGGGTAGGGGAGTGGGTGG - Intronic
1067477060 10:46574192-46574214 GGGGTGAGTAGGGGAGTGCCAGG + Intergenic
1067556675 10:47277896-47277918 GAGAGGGGTAGGGGGGTGGCCGG + Intergenic
1067617681 10:47767589-47767611 GGGGTGAGTAGGGGAGTGCCAGG - Intergenic
1067830786 10:49610161-49610183 GGCCGGGGGCGGGGCGTGGCCGG - Intronic
1068316539 10:55351041-55351063 AGCGGGGGGAGGGGAGGGGGAGG - Intronic
1068631713 10:59304832-59304854 GGCGGGGGAGGGGGAGGGGGAGG + Intronic
1068878046 10:62018600-62018622 GGTGGGGGCGGGGGAGGGGCAGG - Intronic
1069077648 10:64054982-64055004 GGGGGGGGTGGGGGAGTGGAAGG - Intergenic
1069111791 10:64456722-64456744 GGAGGGGGGAGGGGAGGGGGCGG - Intergenic
1069403668 10:68075422-68075444 GGGGGGGGGGGGGGGGTGGCTGG + Intergenic
1069521348 10:69124129-69124151 TGCGGGGGTGGGGGAGAGGAAGG + Exonic
1069593571 10:69656384-69656406 GGCCTGGGTAGGGGAGCGGAGGG + Intergenic
1069597891 10:69684477-69684499 GGGGCGGGGAGGGGAGTGGTTGG - Intergenic
1069786397 10:70990837-70990859 GGCGGTGGTCGGGTTGTGGCCGG + Intergenic
1069832196 10:71288189-71288211 TGCGGGGGTAGGGGAGCAGAGGG - Intronic
1069900260 10:71702780-71702802 GGCTGGGGCAGGGGAGGAGCTGG + Intronic
1070256061 10:74813949-74813971 GGCGGGGGTGGGGGCGGGGTGGG - Intergenic
1070312462 10:75283631-75283653 GGCTGGGGTAGGGGTGGGGGCGG - Intergenic
1070507451 10:77126711-77126733 GGGGGGGGTGGGGGGGTGGGGGG - Intronic
1070572356 10:77649952-77649974 GGCTGGGGTGGGGGGGTGGGAGG + Intergenic
1070646311 10:78204510-78204532 GGGAGGGGCAGGTGAGTGGCAGG + Intergenic
1070788997 10:79178681-79178703 TGCGGGGGTGGGGGAGGGGTGGG - Intronic
1070800547 10:79242550-79242572 GCCGGGGGGAGGGGAGGGGAGGG - Intronic
1070959239 10:80487322-80487344 GGCGGGGGTGGGGGACTTGTCGG + Intronic
1070959305 10:80487734-80487756 GGCGGTGGTAGGGGGGAGGTGGG + Intronic
1070971699 10:80572600-80572622 GGGGAGGGGAGGGGAGTGGAGGG - Intronic
1071320608 10:84452824-84452846 GGTGGGGGGAGGGGGGCGGCGGG - Intronic
1071374487 10:84988710-84988732 GGCTGGGGAAGGGAAGGGGCGGG - Intergenic
1071547318 10:86538461-86538483 GGCGTGGGTGGGGGCGTGGGTGG - Intergenic
1071841647 10:89477850-89477872 GGCGGGGGCAGGGCAGGGGCCGG - Intronic
1071997357 10:91162158-91162180 GGTGAGGGTAGGGAAGTGGAGGG + Intergenic
1072017930 10:91368056-91368078 GACAGGGGTAGGGTAGGGGCTGG - Intergenic
1072190521 10:93073600-93073622 GGCGGCGGTGGGGGAGGGCCAGG - Intronic
1072409198 10:95184391-95184413 GGCGGGGGTGGGGGGATGGCGGG + Intergenic
1072591576 10:96832601-96832623 GGCGCGCGGAGGGGAGGGGCCGG - Intronic
1072631768 10:97151373-97151395 GGTGGGGGTGGGAGAGTGGATGG + Intronic
1072791820 10:98323419-98323441 GGCGGGGGTGGAGGGGTGGCTGG - Intergenic
1072845477 10:98825616-98825638 GGCGGGGGTGGGGGAGGTGTGGG + Intronic
1073015026 10:100391837-100391859 GGCAGGGGTTGGGGAGTGGGGGG - Intergenic
1073189908 10:101643836-101643858 GCCTGGGGTAGGGAAGTGGGGGG + Intronic
1073214633 10:101829631-101829653 GGCGGGGCGAGGGGAGGGGCTGG - Intronic
1073297477 10:102450016-102450038 GGCGGGGGTAGGGGAGCGGTGGG + Exonic
1073325811 10:102643582-102643604 GGCCGGGGGAGGGGAGGGGAGGG + Intergenic
1073400159 10:103250870-103250892 GGTGGTGGTAGTGGAGTGGCAGG - Intergenic
1073422322 10:103434373-103434395 GGTCGGGGAAGGGGAGCGGCAGG + Intronic
1073513590 10:104057971-104057993 GTGGGGGTCAGGGGAGTGGCAGG - Intronic
1073750025 10:106515004-106515026 GGCGGGGGTGGGGGTGGGGAGGG - Intergenic
1073750567 10:106521745-106521767 GGCGGAGGCAGGAGAATGGCGGG + Intergenic
1073956190 10:108874277-108874299 GGAGGGGGAGGGGGAGGGGCAGG - Intergenic
1074136211 10:110628884-110628906 GGGGCGGGTAGGGGGGTGGTAGG - Intergenic
1074173456 10:110970191-110970213 GGCGGGGGTTGGGGAGCAGCGGG - Intronic
1074326315 10:112455199-112455221 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
1074678306 10:115878052-115878074 GTGGGGAGAAGGGGAGTGGCAGG - Intronic
1074679444 10:115889296-115889318 GGTGGGGGTGGGGGTGGGGCAGG - Intronic
1074772505 10:116742820-116742842 GGCGGGGGTAGTGGCGCGCCCGG + Intergenic
1074876083 10:117614413-117614435 AGTGGGGGTGGGGGGGTGGCGGG + Intergenic
1075118716 10:119648851-119648873 GGTGAGGGTTGGGGAGTGACAGG + Intergenic
1075403760 10:122180258-122180280 GGAGGGGGAAGGAGGGTGGCAGG - Intronic
1075481956 10:122789694-122789716 GGCAGGGTTAGGGAAGAGGCTGG - Intergenic
1075595915 10:123729010-123729032 GGGTGGGGTAGGGGAGGGGGAGG - Intronic
1075677869 10:124308726-124308748 GGAGGGGGTAGGGGAGAGCTGGG - Intergenic
1075726499 10:124613393-124613415 GGCAGGGGTGGAGGAGAGGCAGG - Exonic
1075726530 10:124613472-124613494 GGCAGGGGTGGAGGAGAGGCAGG - Exonic
1075982711 10:126755288-126755310 GTCGGGGGTCGGGGGGGGGCGGG + Intergenic
1076053030 10:127350365-127350387 GGAGGGAGTAGGGGAGTGCCTGG - Intronic
1076064973 10:127441685-127441707 GGGGGTGGTGGGGGGGTGGCTGG - Intronic
1076302966 10:129441841-129441863 GGAGGGGGAGGGGGAGTTGCAGG - Intergenic
1076676504 10:132149858-132149880 GGGAGGGGGAGGGGAGGGGCAGG - Intronic
1076676510 10:132149869-132149891 GGTGGGGGTGGGGGAGGGGGAGG - Intronic
1076700010 10:132266700-132266722 GGCGTGGGTGGGGGAGGCGCTGG + Intronic
1076725090 10:132409482-132409504 GGCGGTGGTGGGGGTGTGGGTGG - Intronic
1076757289 10:132579192-132579214 GGCGGGGGAAGGAGAGTGTGGGG + Intronic
1076760847 10:132605202-132605224 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1076760868 10:132605250-132605272 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1076760876 10:132605267-132605289 GGCTGGGGATGGGGAGTGGGTGG + Intronic
1076769722 10:132656427-132656449 GGCGGGGGCAGGGGTGTCCCTGG - Intronic
1076861520 10:133140272-133140294 GGCAGGGGCAGGGCAGGGGCGGG - Intergenic
1076861552 10:133140360-133140382 GGCAGGGGCAGGGCAGGGGCGGG - Intergenic
1076891094 10:133283785-133283807 GGCAGGGCGAGGGGAGAGGCAGG - Intronic
1076902712 10:133347741-133347763 GGCTGGGGGAGGGGAGGGGCTGG + Intronic
1076931707 10:133536362-133536384 TGCGTGGGTAGGGGAGTGGATGG + Intronic
1077014339 11:393231-393253 GGTGGGGGTGGGGTAGTGGGGGG - Intronic
1077044836 11:540193-540215 GGCTGGGGTAGGGGAAGGCCTGG + Intronic
1077050144 11:562884-562906 GTCAGGGGTGGGGGAGTGACAGG - Intronic
1077050170 11:562970-562992 GTCAGGGGTGGGGGAGTGACAGG - Intronic
1077050200 11:563056-563078 GTCAGGGGTTGGGGAGTGACAGG - Intronic
1077144779 11:1040020-1040042 GGCAGGGGCAGGGAAGGGGCTGG - Intergenic
1077204692 11:1336753-1336775 GGCGGGGGGCGGGGCGTGGAGGG + Intergenic
1077338974 11:2017630-2017652 GGCGGGGGCATGGGAGTGGTAGG + Intergenic
1077419731 11:2444718-2444740 GGCGGGGGTGGGGGTGGGGGCGG + Intronic
1077437426 11:2549620-2549642 GCCCGGGGTAGGGGCGTGGGGGG + Intronic
1077787900 11:5404149-5404171 GGCGGGGGGAGGGGATGGGGCGG + Intronic
1077870595 11:6259105-6259127 GGCGGGAGTGGGGGTGGGGCCGG - Intergenic
1077923075 11:6655826-6655848 GGCGGGGGGAGGGGAGGGGAGGG - Exonic
1078390550 11:10932096-10932118 GGTGGGGGAAGGAGAGTGGGAGG + Intergenic
1078771629 11:14357986-14358008 GCTGGGGGTAGGGGAGAGGGTGG + Intronic
1078891364 11:15561192-15561214 GGCGGGGGGCGGGGAGGGGGTGG - Intergenic
1079551079 11:21697861-21697883 GGCTGGGGCAGGAGAATGGCGGG + Intergenic
1079588311 11:22152443-22152465 GGCTGAGGCAGGGGAATGGCGGG - Intergenic
1080613014 11:33921330-33921352 GACTGTGGTAGGGGAGTGGGTGG + Intergenic
1080646266 11:34190237-34190259 GGCAGGGGTGGGGCAGGGGCTGG - Intronic
1080649316 11:34209782-34209804 GGTGGGGGTAGGGGTGGGGGTGG + Intronic
1080830741 11:35891177-35891199 GGTGGGGTTAGGAGAGTGGAGGG - Intergenic
1081545192 11:44066609-44066631 GCCTGGGGTAGGGGGGCGGCGGG - Exonic
1081785282 11:45742187-45742209 GGCTGGGGTAGGAGAATTGCTGG + Intergenic
1081803499 11:45876044-45876066 GGTTGGGGGAGGGGAGTGGCAGG + Intronic
1081814885 11:45933422-45933444 GAAGAGGGAAGGGGAGTGGCTGG - Intronic
1081873378 11:46392977-46392999 GGCGGCGGTGGAGGAGAGGCAGG + Intergenic
1082140062 11:48598751-48598773 GGCGGGGGGAGGGGGGAGGGGGG - Intergenic
1082811051 11:57479194-57479216 GGCAGGGGGAGGGGAGCTGCTGG + Intergenic
1083184242 11:61008196-61008218 GGCGGGGACAGGGAAGCGGCGGG - Intronic
1083261987 11:61528185-61528207 GCTGGGGGTGGGGGAGAGGCCGG + Exonic
1083294523 11:61707875-61707897 GGGCGGGGTAGGGGTGTGGTTGG + Intronic
1083299739 11:61734167-61734189 GGCAGGGGTAGGGGAGGTGAGGG + Intronic
1083626814 11:64076119-64076141 GGCAGGGGCAGGTGACTGGCAGG - Intronic
1083638823 11:64134429-64134451 GGTGGGGGTAGGGGTGAGACTGG + Intronic
1083644752 11:64165799-64165821 GGCGGGAGTTGGGGCGTGGGGGG - Exonic
1083669597 11:64292502-64292524 GGCGGGGACAGGGGAATGGTGGG - Intronic
1083670468 11:64297210-64297232 GGCAGGGGTCGGGGACCGGCTGG + Exonic
1083679033 11:64342860-64342882 GGCAGGTGTAGGGGAGTGGGGGG + Intronic
1083696849 11:64449001-64449023 GGCAGGGGGAGCTGAGTGGCCGG - Intergenic
1083753997 11:64779161-64779183 GGCGGGAGCAGGGGAGGGGCTGG + Intergenic
1083799990 11:65041196-65041218 GCCGGGGGGTGGGGAGCGGCGGG - Exonic
1083853046 11:65378949-65378971 GGCAGGGCCAGGGGAGTGTCAGG + Intronic
1083876014 11:65524935-65524957 GGCGGGGACAAGGGAGGGGCGGG - Intergenic
1083879024 11:65539288-65539310 GGTGGGGGCAGGGGCGGGGCCGG - Intronic
1083905067 11:65663725-65663747 GGCGGGGGCAGGGGGGTGGGGGG - Intergenic
1083977975 11:66139478-66139500 GGTGGGGTTAGGGGGGTGGATGG - Intronic
1084035768 11:66509328-66509350 GGCTGGGGAGGGGGAGGGGCAGG + Exonic
1084088723 11:66866518-66866540 GGCGGGAGCAGGGCAGGGGCTGG - Intronic
1084499752 11:69528406-69528428 GGGTGGGGTGGGGGAGGGGCGGG + Intergenic
1084546969 11:69819430-69819452 GGAGGGGGCGGGGGAGGGGCGGG - Intergenic
1084650282 11:70485536-70485558 GGCGGGGGCGGGGGAGCGGGCGG + Intronic
1084684864 11:70687587-70687609 TGTGGGGGTAGGGGGGTGGGCGG + Intronic
1084861032 11:72018342-72018364 GGCTGGGTGAGGGGAGGGGCTGG + Intronic
1084960246 11:72712695-72712717 GGCAGGGGGAGGGGAGTGTGAGG - Intronic
1085260249 11:75200393-75200415 GGTGGGGGTGGGGCAGGGGCAGG + Intronic
1085336592 11:75701358-75701380 GGCTGGGGCGGGAGAGTGGCAGG - Intergenic
1085404687 11:76254873-76254895 AGCTGGGGGAGGGGAGTGGGAGG + Intergenic
1085416339 11:76321456-76321478 GGGGGGACTGGGGGAGTGGCAGG - Intergenic
1087116989 11:94535940-94535962 GGCGGGGGTGGGGGACTGCTGGG + Intergenic
1087533935 11:99419694-99419716 AGTGGGGGGAGGGGTGTGGCTGG + Intronic
1087594841 11:100240225-100240247 GGCGGGGGTCGGGGGGTGTGGGG - Intronic
1088723190 11:112612418-112612440 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
1089266910 11:117270552-117270574 CGGGGGGGTGGGGGAGTGGGGGG - Intronic
1089352774 11:117830870-117830892 GGGGAGGTTAGGGGAGTGGGGGG - Intronic
1089498378 11:118919113-118919135 GGCGGGGGTTGGGGGGTCGGGGG - Intronic
1089525629 11:119094813-119094835 GGCGAGGGGAGGGGAGGGGAAGG + Exonic
1089543644 11:119206243-119206265 GCCGTGGGGAGGGGAGTGGGCGG - Exonic
1089603794 11:119630071-119630093 GGAGAGGGAATGGGAGTGGCTGG + Intronic
1089667116 11:120027461-120027483 GGCTGGGGTAGGGGAGTAAGAGG - Intergenic
1089817749 11:121191381-121191403 CGAGGGGGTAGGAGAGTGGGTGG - Exonic
1089818052 11:121194235-121194257 CGAGGGGGTAGGAGAGTGGGTGG - Intergenic
1089935417 11:122359371-122359393 GGCGGGGAGAGGGGACTGGAGGG - Intergenic
1090044012 11:123315321-123315343 GGAGGAGGGAGGGGAATGGCAGG - Intergenic
1090064484 11:123491457-123491479 GCTGGGGGAAGGGGAGGGGCAGG - Intergenic
1090640671 11:128726530-128726552 GGTGGGGGTAGGGGGGTGGGAGG - Intronic
1090726322 11:129530420-129530442 GGAGGGGGGAGAGGAGAGGCAGG + Intergenic
1091241277 11:134053916-134053938 GAGGAGGGGAGGGGAGTGGCTGG + Intergenic
1202821958 11_KI270721v1_random:72812-72834 GGCGGGGGCATGGGAGTGGTAGG + Intergenic
1091434020 12:459907-459929 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1091567903 12:1661880-1661902 GGCGGGGGGCGGGGGGAGGCGGG + Intergenic
1091788549 12:3257768-3257790 GGGAGGGGTAGGGGGGCGGCGGG + Intronic
1091795018 12:3293243-3293265 GGCTGGGGAAGGGGAGTCCCGGG + Intergenic
1091900859 12:4142886-4142908 GGCGGGGGAAGGTGAGCAGCAGG - Intergenic
1092170597 12:6371555-6371577 GGTGGGGGTGGGGGTGGGGCGGG + Intronic
1092209552 12:6637510-6637532 GGCTGAGGTAGGAGTGTGGCTGG + Intergenic
1092351379 12:7758612-7758634 GGAGGGGGAAGGGGAAAGGCGGG + Intergenic
1092539800 12:9413642-9413664 GGCGGGGGGCGGGGGGTGGGGGG + Intergenic
1092605631 12:10115329-10115351 GGCTGAGGTAGGAGAATGGCGGG + Intergenic
1092729827 12:11520050-11520072 GGCGGGGGGTGGGGTGTGCCTGG - Intergenic
1093077364 12:14771689-14771711 GGCGGGGGTCGGGGGGAGGTGGG - Intergenic
1093357202 12:18180224-18180246 GTTGGGGGTGGGGGTGTGGCGGG + Intronic
1093662842 12:21776521-21776543 GGAGGGGGTACAGGAGTGGTGGG - Intergenic
1094311411 12:29087422-29087444 GTCAGGGCTAGGGGAGGGGCTGG - Intergenic
1095090424 12:38099404-38099426 GGCGGTGGGGGGGGAGTGGGTGG + Intergenic
1095102851 12:38201826-38201848 GGTGGGGGTGGGAGAGGGGCTGG + Intergenic
1095948467 12:47767186-47767208 GGCTGGGGTGGGGGGGTGGAGGG + Intronic
1095961074 12:47834757-47834779 GGAGGTGGTAGAGGAGTGGATGG - Intergenic
1095991033 12:48034771-48034793 TGCTCGGGTAGGGGAGTGCCCGG - Intergenic
1096024710 12:48350833-48350855 GGAGGGCGGAGGGGAGGGGCAGG - Intronic
1096255009 12:50057593-50057615 GGCGGCGGGAGGGGAGGGGGAGG - Exonic
1096318919 12:50593766-50593788 GGGGGGGGGAGGGGAGGGGAGGG - Intronic
1096336937 12:50764046-50764068 GGCGGGGGCGGGGGAGGGGAGGG - Intronic
1096356879 12:50948863-50948885 GGAGGGGGGAGGGGAGGGGGAGG + Intergenic
1096473915 12:51896461-51896483 GGCCAGGGTAAGGGTGTGGCTGG - Intergenic
1096675146 12:53222003-53222025 GGCGGGCGCGGGGGAGGGGCGGG + Intronic
1096675709 12:53224727-53224749 GGCCTGGGCAGGGAAGTGGCAGG - Intronic
1096785808 12:54016637-54016659 GGTGGGGGTAGGGGTGGGGTGGG + Intronic
1096788293 12:54030297-54030319 GGCGGGGGTGGGGGCGTCGAAGG - Exonic
1096843299 12:54391631-54391653 GGGGTGGGCAGGGGAGTGGGGGG + Intergenic
1097185544 12:57194507-57194529 GGCGGGGGCAGGTGTGTGGTGGG + Intronic
1097190551 12:57217407-57217429 GGCGGGGGTGGAGGGGTGGAAGG - Intronic
1097195247 12:57239353-57239375 GGCGGGAGTGGCGGAGTGACGGG - Intronic
1097691565 12:62738988-62739010 GGCGGGGGCGGCGGAGGGGCGGG + Intronic
1097833832 12:64253465-64253487 GGATGGGGTAGGGGGGTGGTTGG - Intergenic
1098076736 12:66739575-66739597 TGCGGGGGCAGGGAAGTGACAGG + Intronic
1098217802 12:68238447-68238469 GGTGGGAGTTGGGGAGGGGCGGG + Intergenic
1098449354 12:70601889-70601911 GGCTGAGGCAGGGGAATGGCAGG - Intronic
1098571468 12:71992412-71992434 GGCGGGGGTGGGGGTGGGGGTGG - Intronic
1099191420 12:79565216-79565238 GGCGGGGGTGGGGGAGGCTCAGG - Intergenic
1099460152 12:82911329-82911351 GGCGGGGGTGGGGGAAGGGCTGG - Intronic
1099956656 12:89357506-89357528 TGCGGGGGAAGGGGAAAGGCAGG + Intergenic
1100357228 12:93842811-93842833 GGCGGGGGTGGGGGAGAGTAGGG + Intronic
1100447939 12:94678526-94678548 GGCGGGGGTGGGGTGGGGGCAGG - Intergenic
1100468835 12:94873190-94873212 GGCTGGGGTTGGGGAGAGGAAGG - Intergenic
1100504247 12:95204480-95204502 GGGAAGGGTAGGGTAGTGGCTGG - Intronic
1100557216 12:95707503-95707525 GGGGTGGGAAGAGGAGTGGCAGG - Intronic
1100826978 12:98483729-98483751 GGAGGGGGAAGGGGAGGGGAGGG + Intergenic
1100877688 12:98980299-98980321 GGCTGAGGTAGGAGAATGGCGGG - Intronic
1101548067 12:105735503-105735525 GGTGGGGGTGGGGGGGTGGGGGG + Intergenic
1101570171 12:105946503-105946525 AGCGGGGGGTGGGGAGTGGGGGG - Intergenic
1101885001 12:108655345-108655367 GGAGGGGGAAGGGGAGAGGGAGG - Intronic
1102003439 12:109573335-109573357 GACGGGGACAGGTGAGTGGCTGG - Exonic
1102003575 12:109573863-109573885 GGCGGCGGCAGGTGAGAGGCCGG + Exonic
1102009190 12:109607593-109607615 GGCGGGGGTGGGGGGGTCGGGGG - Intergenic
1102455812 12:113070296-113070318 ACCGGGGGTTGGGCAGTGGCTGG - Intronic
1102554547 12:113718352-113718374 GGTGGGGGTGGGTGAGAGGCAGG + Intergenic
1102587489 12:113933347-113933369 GGTGGGGGTGGGGGAGGAGCAGG + Intronic
1102770314 12:115470575-115470597 GGCTGGGGTGGGGGACTGGGCGG - Intergenic
1102816568 12:115870593-115870615 GGTGGGGGGAGGGGTGGGGCGGG + Intergenic
1103229863 12:119320394-119320416 GGCTGAGGTAGGAGAATGGCTGG - Intergenic
1104049991 12:125188530-125188552 GACGGGGGTGGGGGGGTGGTAGG - Intronic
1104178779 12:126357859-126357881 GGAGGGGATAGGGGAGGGACGGG + Intergenic
1104376187 12:128267102-128267124 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1104647197 12:130505709-130505731 GGTGGGGGGAGCGGAGTGGGTGG - Intronic
1104651045 12:130534243-130534265 GGTGGTGGGAGGGGAGTGGAAGG + Intronic
1104672851 12:130692319-130692341 GGAAGGGGTAGGGGAGAGGATGG - Intronic
1104854331 12:131894962-131894984 GGCGCGGGGCGGGGGGTGGCGGG - Exonic
1104886053 12:132109207-132109229 GGAGAGGGGAGGGGAGGGGCGGG - Intronic
1104927630 12:132321922-132321944 GGCGGGGGCTGGGGAGAGGCAGG - Intronic
1104933699 12:132353573-132353595 GGCGGGGTTGGGGCAGAGGCTGG - Intergenic
1104974724 12:132547463-132547485 GCCGGGGGCAGAGGAGGGGCTGG - Intronic
1105030094 12:132876073-132876095 GGCTGGGGCAGGAGAATGGCTGG + Intronic
1105594232 13:21821081-21821103 GGAAGGGGTAGGGGAGAGGGTGG + Intergenic
1105699599 13:22926400-22926422 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1106258232 13:28040897-28040919 GGCCGAGGTAGGGGAATTGCTGG + Intronic
1106373258 13:29158328-29158350 GACGGGGGTTGGGGGGTGGGGGG - Intronic
1106517031 13:30464975-30464997 GGAGGGAGACGGGGAGTGGCGGG - Intronic
1106562881 13:30862082-30862104 GGGAGGGGTTGGGGGGTGGCAGG - Intergenic
1106582811 13:31032363-31032385 AGAGGGGGCAGGGGAGTGGCGGG - Intergenic
1107111242 13:36700290-36700312 GGGTGGGGTATGGGAGTGGGTGG + Intergenic
1107290921 13:38852128-38852150 TGGGAGGGTGGGGGAGTGGCAGG - Intronic
1107461347 13:40606658-40606680 GGTGGGGCTGGGGGAGAGGCAGG + Intronic
1107616050 13:42169518-42169540 ATTGGGGGTTGGGGAGTGGCTGG - Intronic
1108066098 13:46578874-46578896 GGCGGGAGGAGGGGAGATGCTGG + Intronic
1108206453 13:48095014-48095036 GGAGGCGGTTTGGGAGTGGCGGG - Exonic
1108359048 13:49652622-49652644 GGGGGGGGCAGGGGGGTGGGGGG + Intergenic
1108408351 13:50125618-50125640 GGCGGGGGGAGGGGAGGGGGAGG - Intronic
1108682366 13:52790906-52790928 GGCAGGGGGAGGGGAGGGGAGGG - Intergenic
1109152721 13:58863746-58863768 GGGGGAGGTGGGGGAGTGGGAGG - Intergenic
1109667018 13:65553058-65553080 GGGGGGGGTGGGGGAGCGGTGGG + Intergenic
1109781300 13:67113646-67113668 GGCTGAGGCAGGAGAGTGGCGGG - Intronic
1110010846 13:70331661-70331683 GGCAGGGGTTGGGGAGTGGGTGG + Intergenic
1110318268 13:74134537-74134559 GGCGGGGGCAGGGGTGGGGCGGG - Intergenic
1111424579 13:88063097-88063119 GGTGGAGGAAGTGGAGTGGCTGG - Intergenic
1111543707 13:89701560-89701582 GGGGGGTGGAGGGGGGTGGCGGG - Intergenic
1111978963 13:94997017-94997039 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1112344328 13:98577214-98577236 GGGAGGGGGAGGGGAGAGGCCGG + Intronic
1112503706 13:99960828-99960850 GGCAGGGCCAGGGGAGTCGCCGG - Intergenic
1112560253 13:100506376-100506398 GGCGGGGGTGGGGGCGGGGGCGG + Intronic
1112919831 13:104598284-104598306 GGCTGGGGGAGGGGTGTGGGGGG + Intergenic
1113254831 13:108495650-108495672 CGCGCGGGGAGGGGAGAGGCGGG + Intergenic
1113360116 13:109622934-109622956 GGGGAGGGGAGGGGAGTGGGGGG - Intergenic
1113469520 13:110534478-110534500 GGCAGGGGTCGGGGCGTGGTCGG - Intronic
1113655569 13:112066480-112066502 GGCGGGGGCAGAGGAGGAGCTGG + Intergenic
1113706507 13:112436766-112436788 GGCAGGGGTGGGTGAGTGTCGGG + Intergenic
1113777489 13:112956182-112956204 GGCGCAGGCACGGGAGTGGCAGG + Intronic
1113794799 13:113050765-113050787 GGCGGGGGGAGGGGGGCGGCAGG + Intronic
1113884962 13:113653663-113653685 GGTGGGGGGTGGGGGGTGGCTGG + Intronic
1113900445 13:113793917-113793939 GGCGGGGGGTGGGGGCTGGCGGG - Intronic
1114259360 14:21025803-21025825 GGCGGGGGGTGGGGAGAGGATGG + Intronic
1114330000 14:21627297-21627319 GGCTGAGGTAGGAGAATGGCGGG - Intergenic
1114500013 14:23161587-23161609 GGTGGGGGTAGGTGGGTGGGTGG + Intronic
1114517035 14:23306941-23306963 GGTGGGGGTAAGGGAGGAGCTGG + Intronic
1114530509 14:23392665-23392687 GGTGGGGGTGGGGGAGTGACAGG + Intronic
1114674053 14:24429590-24429612 GGAGGGGGTAGGCGGGAGGCGGG - Intronic
1114872153 14:26671692-26671714 GGAGGGGTTAGGGGAGTTGCAGG + Intergenic
1115650271 14:35398061-35398083 GCTGGGGGTGGGGGAGTGGGTGG + Intergenic
1116459696 14:45158416-45158438 GGGTGAGGTAGGGGGGTGGCGGG - Intronic
1116676505 14:47912612-47912634 GGCAGGGATAAGGGGGTGGCTGG + Intergenic
1116951673 14:50883680-50883702 GGGTGGGGAAGGAGAGTGGCTGG + Intronic
1117043480 14:51789244-51789266 GGGAGGGGTAGGGGAAAGGCAGG - Intergenic
1117127970 14:52651940-52651962 GGCTGGGGGTGGGGAGTGGATGG - Intronic
1117156993 14:52951187-52951209 GGCGGGGGCAGAGGCGAGGCCGG - Intronic
1117252656 14:53952233-53952255 GGGAGGGGGAGGGGAGTGGAAGG + Intronic
1117368278 14:55052113-55052135 GGAAGGGGTGGGGGAGGGGCCGG - Intronic
1117494536 14:56289603-56289625 GGCGGGGGTTGGGGGGTGGTGGG - Intronic
1117531527 14:56664878-56664900 GGCTGGGGTGGGGTAGTGGTGGG - Intronic
1118663128 14:68037107-68037129 GGGGAGGGTAGGGGAGGGGAGGG - Intronic
1118931937 14:70250797-70250819 GGTGGGGGTGGGGGATGGGCAGG + Intergenic
1118967443 14:70600875-70600897 GGGTGGGGTAGGGGAATGGGAGG + Intergenic
1119017288 14:71071925-71071947 GGGAGAGGTAGGGGAATGGCTGG + Intronic
1119084118 14:71723976-71723998 GGCCGGGCTAGGGGGTTGGCAGG + Intronic
1119240910 14:73058829-73058851 GGCGGGGGTGGGGGAGGGGTCGG + Intronic
1119422947 14:74518395-74518417 GGCGAGGGTAGGAGAGGTGCGGG - Intronic
1119716687 14:76864426-76864448 GCGGGGGGAAGGGGGGTGGCGGG + Intronic
1119748582 14:77061849-77061871 GGCGGGAGTGGGGGTGGGGCTGG + Intergenic
1120170735 14:81245282-81245304 GGAGGGGGAAGGGGAGGGGGAGG + Intergenic
1120203482 14:81563243-81563265 GGCGTGAGAAGGGGACTGGCAGG - Intergenic
1120857588 14:89226111-89226133 GGCGGGGGGAGGGGAGGGGAAGG + Intronic
1121003100 14:90466062-90466084 GGCGGGGACAGGGGAGGGTCTGG - Intergenic
1121050363 14:90816068-90816090 GGCGCGGGCAGGGGCGCGGCCGG - Intronic
1121137222 14:91509964-91509986 GGCGGGAGCAGGGCAGTGACGGG - Exonic
1121584300 14:95052323-95052345 GGCGGGGCCTGGGGGGTGGCAGG - Intergenic
1121861272 14:97321006-97321028 GACGTGGGCAGGGGAGGGGCAGG + Intergenic
1122144872 14:99683455-99683477 GGCGGGGGTAGCGGAGGAGAAGG - Intergenic
1122214507 14:100193955-100193977 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1122298355 14:100718030-100718052 GGGGGGAGTAGGTGGGTGGCAGG - Intergenic
1122328574 14:100897755-100897777 GGGGGGGGTGGGGGGGTGGGGGG + Intergenic
1122378690 14:101286333-101286355 GCCGAGGGCAGGGGAGTGGCGGG + Intergenic
1122612265 14:102993605-102993627 GGGGAGGGTAGGGGAAGGGCTGG - Intronic
1122666513 14:103334011-103334033 GGCGGGGGGAGGGGAGAGGAAGG + Exonic
1122782248 14:104148667-104148689 GGGAGGGGGAGGGGAGGGGCAGG + Intronic
1122853481 14:104548782-104548804 GGCGGGGGTGGGGGCAGGGCAGG - Intronic
1122853501 14:104548824-104548846 GGCGGGGGTGGGGGCAGGGCAGG - Intronic
1122881255 14:104691471-104691493 GATGGAGGTAGGGGAGGGGCTGG - Intronic
1122882636 14:104696964-104696986 GGCGGGGGTAGGGCAGGCACTGG - Intronic
1122939275 14:104973971-104973993 GGCAGGGGATGGGGAGGGGCTGG - Intronic
1123033241 14:105460966-105460988 GGTGGCGATGGGGGAGTGGCTGG + Intronic
1123056628 14:105574008-105574030 GGCAGGGGTAGTGGAGTGGGCGG + Intergenic
1123104916 14:105836861-105836883 GGCCGGGGCAGGGGTGTAGCTGG + Intergenic
1123191510 14:106576361-106576383 GGCAGGGGGTGGGGAGTGGCAGG + Intergenic
1123485385 15:20730974-20730996 GGTGGGGGTGGGGGATTGGGAGG + Intergenic
1123587001 15:21769810-21769832 GGTGGGGGGTGGGGGGTGGCGGG + Intergenic
1123623639 15:22212375-22212397 GGTGGGGGGTGGGGGGTGGCGGG + Intergenic
1123794904 15:23761613-23761635 GGCTGGGGGAGGGGAGTGGTTGG + Intergenic
1124245613 15:28069393-28069415 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
1124452762 15:29811426-29811448 GGTGGGGGTGGGGGGGTGGTGGG + Intronic
1125031305 15:35078783-35078805 GGGGAGGGTAGGGGAGGAGCGGG - Intergenic
1125194080 15:37026626-37026648 GGCGGGGGGAGAGTGGTGGCTGG + Intronic
1125415777 15:39450717-39450739 AGCTGAGGTGGGGGAGTGGCTGG + Intergenic
1125530248 15:40408476-40408498 GGGGGGAGTAGGGTAGGGGCTGG + Intronic
1125565945 15:40678483-40678505 GGCTGAGGTAGGAGAATGGCGGG - Intergenic
1125929497 15:43590136-43590158 GGGGGCGGTGGGGGAGTGGCTGG - Intronic
1125942664 15:43689968-43689990 GGGGGCGGTGGGGGAGTGGCTGG - Intergenic
1126348412 15:47719150-47719172 GGCGGGGGTGGGGGTGTGGAGGG + Intronic
1126500640 15:49340400-49340422 GGGGGGGGGAGGGGGGGGGCGGG - Intronic
1126849269 15:52787628-52787650 GTGGGGGGTGGGGGAGTGGGGGG + Intronic
1126864832 15:52925190-52925212 GGCGGGGGTGGGGGGGCGGGGGG + Intergenic
1127168403 15:56272041-56272063 GGCTGAGGCAGGGGAATGGCCGG + Intronic
1127222884 15:56899005-56899027 GTCGGGGGTAGGGGAGCGGGGGG + Intronic
1127362734 15:58259327-58259349 GGGAGGGGTAGGGGAGGGGCAGG + Intronic
1127732622 15:61814528-61814550 GGCAGGGGGTGGGGAGTGGTTGG + Intergenic
1127790606 15:62395220-62395242 GGCGGGGGTGGGGTAGAGGGTGG + Intronic
1127809377 15:62550087-62550109 GGCTGGGGTAGGGGAAGAGCAGG + Intronic
1127872964 15:63088614-63088636 GGTGGGGGGCGGGGAGGGGCCGG - Intergenic
1128087255 15:64894710-64894732 GGCGTAGGTAGGGGAGGGCCTGG + Intronic
1128557764 15:68643291-68643313 GGGGAGGGGAGGGGAGAGGCTGG + Intronic
1128613881 15:69094505-69094527 GGCGGGGCTCAGGGAGGGGCTGG - Intergenic
1128618320 15:69127825-69127847 GCAGGGGGCAGGGGAGGGGCAGG - Intergenic
1128683429 15:69667441-69667463 GGCGGGGGGGGGGGGGGGGCGGG - Intergenic
1129161078 15:73748281-73748303 GGCTGGGGAAGGGGAGCAGCAGG + Intronic
1129185904 15:73906303-73906325 GGAGGAGGTCGGGGAGAGGCTGG + Intergenic
1129220505 15:74129203-74129225 GGCAGGAGTAGGGGAGAGGGAGG + Exonic
1129226721 15:74174507-74174529 TGCTGGGGGAGGGGGGTGGCTGG + Intronic
1129272215 15:74424945-74424967 GGCAGGGGTCGGGGAGAGGGCGG + Intronic
1129274088 15:74434016-74434038 GGCGGGGGGAGGGGCGGGGTGGG - Exonic
1129287969 15:74541153-74541175 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
1129423638 15:75450468-75450490 GGTGATGGTAGGGGAGGGGCAGG - Intronic
1129423990 15:75451703-75451725 GGCGGGGTCGGGGGAGTGGGCGG - Exonic
1129473878 15:75770250-75770272 GGGGGAGGTAGGGGTGAGGCAGG - Intergenic
1129561463 15:76575230-76575252 GGCAGGGGTGGGGGTGTGGGGGG + Intronic
1129651485 15:77493834-77493856 GACTGGGGCAGGGGAATGGCTGG + Intergenic
1130010842 15:80152481-80152503 GGCGGGGCCAGGGGAGGGGCGGG + Intronic
1130010893 15:80152614-80152636 GGCGGGGCGAGGGGAGGGGCGGG + Intronic
1130010902 15:80152631-80152653 GGCGGGGCGAGGGGAGGGGCGGG + Intronic
1130010929 15:80152700-80152722 GTCGGGGCAAGGGGAGGGGCGGG + Intronic
1130010956 15:80152766-80152788 GGCGGGGCCAGGGGCGGGGCGGG + Exonic
1130232903 15:82110058-82110080 GAAGGGGGAACGGGAGTGGCTGG - Intergenic
1130307098 15:82720503-82720525 GGCAGGGGGAGGGGAGGGGGAGG - Intergenic
1131048655 15:89332597-89332619 GGCGGGGGCAGGGGGGCGGGGGG + Intronic
1131062295 15:89411428-89411450 CGCGGGGGGAAGGGGGTGGCGGG + Intergenic
1131197081 15:90364292-90364314 GGAGGAGGGAGGGGATTGGCAGG - Intronic
1131396039 15:92087147-92087169 GGCGGAGGGAGGGGGGTGGTGGG - Intronic
1131650102 15:94388972-94388994 GGTCGGGGTTGGGGGGTGGCAGG + Intronic
1132149209 15:99447640-99447662 GGCGGGGTTAGCGCAGTGCCTGG + Intergenic
1132354187 15:101159242-101159264 GGGGGGTGTAGGGGAATGGCTGG - Intergenic
1202950188 15_KI270727v1_random:27165-27187 GGTGGGGGTGGGGGATTGGGAGG + Intergenic
1132468227 16:87626-87648 GGCGGGAGGAGGAGAATGGCGGG - Intronic
1132522404 16:397655-397677 GGTGGGGGTGGGGGTGTGGGGGG + Intronic
1132522425 16:397693-397715 GGTGGGGGTGGGGGTGTGGGGGG + Intronic
1132552889 16:560579-560601 GGCGCGGGGCGGGGAGGGGCGGG + Exonic
1132652142 16:1026129-1026151 GGCGGGGGCTGGGGAGTGGTGGG + Intergenic
1132663757 16:1072707-1072729 GGCGGGGGCGGGGCAGTGCCTGG - Intergenic
1132683477 16:1153079-1153101 GGCGGGGGGCGGGGCGGGGCGGG - Intergenic
1132774008 16:1581783-1581805 GGGGAGGGGAGGGGAGTGGAGGG + Intronic
1132800798 16:1751996-1752018 GGCGGGGGTCAGAGTGTGGCTGG - Intronic
1132807784 16:1783026-1783048 GGCGGCGGCCGGTGAGTGGCGGG + Exonic
1132851450 16:2026762-2026784 CGCGGAGGTAGGGGCCTGGCCGG + Intronic
1132851479 16:2026818-2026840 GGCGGGGGCGGGGAAGGGGCGGG + Intronic
1132885855 16:2181652-2181674 GGCCGGGCTAGGGGCGGGGCTGG + Intronic
1132892537 16:2211295-2211317 TGCGGGGGCTGGGAAGTGGCTGG - Exonic
1132931646 16:2461823-2461845 GACGGGGGTAGGGGAGAACCGGG + Intronic
1133006348 16:2883653-2883675 GGCGGGGGTTGGGGGGTGCCGGG - Intronic
1133029636 16:3004331-3004353 GGCGGGGGCAGCGGGGTGGGCGG - Intergenic
1133050643 16:3115562-3115584 GGCGGAGGTAGGAGAGGGACGGG + Exonic
1133069397 16:3235576-3235598 TGGCGGGGTAGGGGGGTGGCGGG - Intronic
1133069546 16:3235866-3235888 GGGGAGGGTAGGGGGGTGGGGGG - Intronic
1133325821 16:4941693-4941715 GGCTGAGGTAGGAGAATGGCTGG - Intronic
1133377308 16:5298471-5298493 GGCGAGGGGAGGGGAGGGGAAGG - Intergenic
1133448580 16:5884458-5884480 GGCGGGGGTAGGGGGGTGGTGGG - Intergenic
1133568836 16:7022027-7022049 GGAGGGGGAAGGGGAGGGGAAGG - Intronic
1133984108 16:10654930-10654952 GGGGGGGGTGGGGGAGGGGAGGG - Intronic
1134018574 16:10906452-10906474 GGTGGGGGTATGTGAGAGGCAGG - Intronic
1134063315 16:11211737-11211759 TGCAGCGGTAGGGGAGTGGAGGG - Intergenic
1134077142 16:11299931-11299953 GGGGTGGGTGGGGGAATGGCGGG - Intronic
1134332801 16:13265552-13265574 GGTGAAGGTAGGGGAGTGGAGGG - Intergenic
1134523173 16:14927751-14927773 GGCTAGGGGAGGGGAGGGGCTGG - Intronic
1134690989 16:16190925-16190947 CTGGGGGGTAGGGGGGTGGCGGG + Intronic
1134710840 16:16326402-16326424 GGCTAGGGGAGGGGAGGGGCTGG - Intergenic
1134799640 16:17071831-17071853 GGGGAGGGGAGGGGAGTGGAGGG - Intergenic
1134948761 16:18342243-18342265 GGCTAGGGGAGGGGAGGGGCTGG + Intergenic
1135135297 16:19882792-19882814 GGTGGGGATAGGGGAATGGTAGG - Intronic
1135321533 16:21501471-21501493 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
1135437417 16:22437748-22437770 GGCGGGGGTGGGGGGGCGGGGGG + Intergenic
1135603345 16:23801764-23801786 GGGGGGGGGAGGGGAGGGGAGGG - Intergenic
1135751965 16:25065405-25065427 GGCGGGGGCAGGAGCGTGGGGGG + Intergenic
1135986503 16:27188582-27188604 GGGGAGGGGAGGGGAGTGGAGGG + Intergenic
1136111085 16:28063832-28063854 GGCGGGGGCCTGGGAGTGGAGGG + Intergenic
1136365553 16:29807518-29807540 GGCGGGGGAGGGGGAGAGGCGGG + Exonic
1136365772 16:29808543-29808565 GGAGGGGGGAGGGGCGTGGGGGG - Intronic
1136416020 16:30104411-30104433 GGCGGGGGCAGCAGAGGGGCTGG + Intergenic
1136578060 16:31135768-31135790 GGCGGGGCCAGGGGAGGGGCGGG - Intergenic
1136605577 16:31331282-31331304 GGAGGGGGTGGGGGAGCAGCGGG - Intronic
1136618650 16:31413466-31413488 GGCTGGGGGAAGGCAGTGGCTGG - Intronic
1136751373 16:32638332-32638354 GGTGGGGGCAGGGCAGAGGCAGG + Intergenic
1136913088 16:34159898-34159920 GGCGGTGGGAGGGGGGTGGTGGG - Intergenic
1137401350 16:48156416-48156438 GGCAGGGGTAGGGGAGGGCAGGG + Intergenic
1137401358 16:48156432-48156454 GGCAGGGGTAGGGGAGGGCAGGG + Intergenic
1137408720 16:48209965-48209987 GGCAGGGATAGGGCAGTGGAGGG + Intronic
1137693133 16:50442858-50442880 GGGGGGGGTGGGGGGGTGGGGGG + Intergenic
1137765863 16:50977257-50977279 GGCGGGGGGAGGGGGCAGGCAGG - Intergenic
1137918282 16:52456507-52456529 GGTGGGGGTAGGGGAGTGCCTGG + Intronic
1138200063 16:55081897-55081919 GGGGAGGGGAGGGGAGTGGAGGG - Intergenic
1138328228 16:56192389-56192411 GGCAGGGGGTGCGGAGTGGCCGG - Intronic
1138347311 16:56328039-56328061 GACTGGGGGAGGGGAGGGGCTGG - Intronic
1138453326 16:57106431-57106453 GGCGGGGGTAGGGTAGTGATGGG + Intronic
1138515917 16:57535619-57535641 GGCTGGGGTCGGGGTGGGGCTGG - Intronic
1138542196 16:57695226-57695248 GGTGGGGGTGGGGGAGTGGTGGG - Intronic
1138563444 16:57815834-57815856 GCCTGAGGTGGGGGAGTGGCAGG - Intronic
1138620431 16:58206739-58206761 GGTTGGGGTTGGGGAGTGGTGGG - Intergenic
1138660366 16:58512887-58512909 GACGGGGGAAGGGTTGTGGCGGG + Exonic
1139096362 16:63709268-63709290 GGCAGGGGTAGAAGAGTGGCAGG - Intergenic
1139299550 16:65933702-65933724 GGGGAGGGTAGGGGAGAGACGGG + Intergenic
1139459127 16:67108236-67108258 GGCCGGGGGAGGGGGGTGGTGGG + Intergenic
1139496958 16:67326835-67326857 GGCGGTGGCAGGTGAGCGGCGGG + Exonic
1139549690 16:67666562-67666584 GGCAGGGGCCCGGGAGTGGCGGG - Exonic
1139652264 16:68368333-68368355 GGCGGGGGCAGGGGGGCGGGAGG + Intronic
1140035321 16:71367427-71367449 GGCTGGGGTAGAGGAGGGGCTGG - Intronic
1140087405 16:71809204-71809226 TGAGGGGGTAGGGGGGTGGGGGG + Intergenic
1140087415 16:71809219-71809241 GTGGGGGGTAGGGGGGTGGGGGG + Intergenic
1140148223 16:72333092-72333114 GGCAGGGGCAGGGCACTGGCAGG + Intergenic
1140388095 16:74560453-74560475 TGCGGGGGCAGGGGGGCGGCGGG - Intronic
1140426505 16:74865964-74865986 GGCGAGGGGAGGGGAGGGGAGGG + Intergenic
1140766635 16:78165538-78165560 AGATGGGGTAGGGGAATGGCAGG + Intronic
1141015420 16:80444507-80444529 GGCTGGGGAAGGGGAGTGTCAGG - Intergenic
1141083754 16:81076967-81076989 GGCGGGGTCTGGGGAGGGGCGGG - Intronic
1141128036 16:81415131-81415153 GGGGGAGGCAGGGAAGTGGCGGG + Intergenic
1141132165 16:81444411-81444433 GGCGGGGGTGGGTGAGGCGCGGG + Intergenic
1141132360 16:81444953-81444975 GGCGGGCGACGGGGAGGGGCGGG - Intergenic
1141524670 16:84603963-84603985 GGAGGTGGGTGGGGAGTGGCGGG - Intronic
1141526310 16:84614241-84614263 AGCGGAGGTAGCGGAGGGGCAGG + Intronic
1141610266 16:85177175-85177197 GGAGGGGGAAGGGGTGAGGCTGG + Intronic
1141624226 16:85253055-85253077 GGGGGGGGTGGGGGGGGGGCGGG - Intergenic
1141639717 16:85334073-85334095 GGCAGGAGCAGGGGAGTGGCTGG - Intergenic
1141642415 16:85348958-85348980 GGCTGGGGTTGGGGAGCGGCAGG - Intergenic
1141694752 16:85614078-85614100 GCGGGGGGGAGGGGAGGGGCAGG - Intronic
1141900351 16:86986893-86986915 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
1141973090 16:87495820-87495842 GATGGGGGTAGGGGAGGGGTGGG - Intergenic
1142159789 16:88551239-88551261 GGCTGGGGAGGGGGAGAGGCAGG - Intergenic
1142205395 16:88780383-88780405 GGTGGGGGTAGGGGAAGGGGGGG + Intronic
1142209863 16:88803908-88803930 GGCGGGGCTGGGGGTGCGGCAGG - Exonic
1142315761 16:89344024-89344046 GGCCGGGCTTGAGGAGTGGCTGG - Intronic
1142360166 16:89622260-89622282 GGCCAGGGGAGGGGAGAGGCAGG + Intronic
1142378861 16:89720881-89720903 GGCGGCGGTAGCCGAGGGGCTGG + Exonic
1142440407 16:90094268-90094290 GGTGGGGGTGGGAGAGCGGCTGG + Intergenic
1203053507 16_KI270728v1_random:897587-897609 GGTGGGGGCAGGGCAGAGGCAGG + Intergenic
1142483599 17:233228-233250 GCGGGGGGTAGAGCAGTGGCTGG - Intronic
1142586781 17:979184-979206 GGCAGGGGTCGGGGGGTGGAGGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142686191 17:1578196-1578218 GGCGAGGGTGTGGGAATGGCCGG - Intronic
1142831674 17:2553800-2553822 GCTGAGGGTAGGGCAGTGGCAGG - Intergenic
1142848148 17:2691964-2691986 GGCGGGGGCGGGGGCGGGGCGGG - Intronic
1143146799 17:4781913-4781935 GGCGGGTGAAGGGGAGAGGGGGG - Intronic
1143583832 17:7841777-7841799 GGTGGGGGGCGGGGAGGGGCCGG + Intronic
1143585271 17:7847692-7847714 GGCGGGGACAGGGGGGTGGAGGG - Exonic
1143593991 17:7903226-7903248 GGGTGGGTCAGGGGAGTGGCCGG - Intronic
1143594766 17:7907573-7907595 GGAGGGGGTAGGGGATAGGAAGG - Intronic
1143617767 17:8064060-8064082 GGAGGGGGTAGGGGTGAGGTGGG - Intergenic
1143979376 17:10854925-10854947 GGAGGTGGGAGGGGAGTGGATGG + Intergenic
1144167260 17:12624938-12624960 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
1144555088 17:16274929-16274951 GGCTGGGGCAGGAGAATGGCTGG + Intronic
1144754270 17:17669793-17669815 GGAGGGAGTAGGAGAGGGGCTGG - Intergenic
1144784362 17:17823665-17823687 GGCGGGGCTGGGGGCGGGGCGGG - Intronic
1144806180 17:17969420-17969442 TGCGGGGGTGGGGGATTGGTGGG - Intronic
1145191312 17:20843452-20843474 GGCGGGGGTAGGGGAGGCCCTGG - Intronic
1145221524 17:21093379-21093401 GGCGGGGGTGGGGGGGTGTTAGG + Intergenic
1145388301 17:22435236-22435258 GGAGGGGGAAGGGGTGCGGCTGG - Intergenic
1145935349 17:28711772-28711794 GGCGGGGTTAGGGGCTAGGCGGG - Exonic
1145979233 17:29002104-29002126 GGTGGGGGTAGGGGTGGGGTTGG + Intronic
1146046387 17:29512038-29512060 GCGGGGGGTAGGGGGGAGGCCGG - Intronic
1146062383 17:29614087-29614109 TGCCGGGGTGGGGGAGGGGCTGG - Exonic
1146163657 17:30572735-30572757 GGAGTGGGGAGGGGACTGGCTGG - Intergenic
1146255908 17:31391587-31391609 GGGGCGGGGAGGGGAGGGGCGGG - Intergenic
1146256087 17:31392119-31392141 GGCGGAGGGAGGGGATTGGGAGG - Intronic
1146390709 17:32419956-32419978 GGCTGAGGTAGGGGAATCGCTGG + Intergenic
1146621023 17:34398101-34398123 GGCTGGGGCAGAGGTGTGGCAGG - Intergenic
1146759110 17:35460662-35460684 GGCGGGGGCGGGGGCGGGGCCGG - Intergenic
1146901419 17:36591925-36591947 GGCGGCGGCAGGAGAGCGGCCGG + Exonic
1147045496 17:37748768-37748790 GGCTGGGAGAGTGGAGTGGCAGG - Intergenic
1147132837 17:38419206-38419228 GGCGGGCGGAGGGGCGGGGCCGG + Intergenic
1147162064 17:38574107-38574129 GGCGGAGGAGGGGTAGTGGCAGG - Intronic
1147168706 17:38606052-38606074 GGCGGGGGCGGGGGAGGGGAGGG + Intergenic
1147241494 17:39093613-39093635 GGCTGAGGTAGGGGAATCGCTGG + Intronic
1147325414 17:39667519-39667541 GGCTTGGGCAGGGGAGGGGCAGG - Intergenic
1147364857 17:39952987-39953009 GGCGGGGCTGGGGCAGAGGCGGG + Intergenic
1147364924 17:39953171-39953193 GGCGGGGCTGGGGTAGAGGCGGG + Intergenic
1147364926 17:39953176-39953198 GGCTGGGGTAGAGGCGGGGCTGG + Intergenic
1147400596 17:40178125-40178147 GGCGGGGGTCGCGGAGGAGCCGG + Intronic
1147426412 17:40347842-40347864 AGAGGGGGCGGGGGAGTGGCCGG + Intronic
1147524935 17:41213447-41213469 GGCTGAGGCAGGGGAATGGCTGG - Intronic
1147565785 17:41535865-41535887 GGCTGGGGGATGGTAGTGGCAGG - Intergenic
1147703105 17:42408252-42408274 AGCAGGGGTAGGGGAGAAGCGGG - Intronic
1147780116 17:42934988-42935010 GGGGAGGGGAGGGGAGTGGATGG - Intergenic
1147970254 17:44215612-44215634 GGTGGGAGGAGGGGAGAGGCTGG - Intronic
1147970832 17:44218664-44218686 GGCGGGGGAAGAGGAAGGGCGGG + Intronic
1148018502 17:44538916-44538938 GGTGGGGGTAGGGGAGGGGAGGG - Intergenic
1148048706 17:44759060-44759082 GGCGGGGGTCGCGGAGAGGTGGG - Exonic
1148077575 17:44947721-44947743 GGCGCGGGTAGGGGAGGGTGTGG - Intergenic
1148128244 17:45247772-45247794 GGCTGGTGGAGGGGAGGGGCAGG - Intergenic
1148139352 17:45317188-45317210 GGTTGGCGTAGGGGAGTGGGCGG - Intergenic
1148150869 17:45395936-45395958 GGATGGGGTAGGGGCGTGGCGGG - Intronic
1148171616 17:45525827-45525849 GGGGAGGGGAGGGGAGTGGACGG - Intergenic
1148188397 17:45661297-45661319 GACAGGGATAGGGCAGTGGCCGG + Intergenic
1148244972 17:46024675-46024697 GACGGGGGTTGGGGTGGGGCGGG + Exonic
1148262055 17:46192953-46192975 GTCGGGGGGAGGAGAGCGGCGGG - Intronic
1148277755 17:46320582-46320604 GGGGAGGGGAGGGGAGTGGAGGG + Intronic
1148299962 17:46538437-46538459 GGGGAGGGGAGGGGAGTGGAGGG + Intronic
1148323762 17:46771880-46771902 GGCGGGGGCAGGGGCGGGGGCGG - Intronic
1148602064 17:48901761-48901783 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
1148615423 17:48997119-48997141 GGCTGGGGTAGGGGGATGGGTGG + Intergenic
1148690893 17:49526298-49526320 GGCCGGGGTAGCGGGGAGGCAGG - Intergenic
1148782726 17:50130548-50130570 GGCCAGGGTAGGGAAGTGCCAGG + Intergenic
1148835406 17:50463299-50463321 GGCAGGGGTGGGGGGCTGGCTGG + Intronic
1148871196 17:50659559-50659581 GGTGGGGGCAGGAGAATGGCTGG + Intronic
1149089624 17:52762629-52762651 TGCGGGGGTTGTGGAGTAGCAGG - Intergenic
1149179626 17:53918740-53918762 GGTGGGGGGAGGGGGGAGGCGGG + Intergenic
1149315182 17:55431959-55431981 GGAAGGGGAAGGGGAGTGGAGGG + Intergenic
1149353901 17:55819505-55819527 GGCTGAGGTAGGAGAGTGGGAGG + Intronic
1149450738 17:56748201-56748223 GGTGGGGGTAGAGGAAGGGCTGG - Intergenic
1149516199 17:57282808-57282830 GGCTGGGGTTGGGGGGTGGGGGG + Intronic
1149548016 17:57518741-57518763 TGCTGGGGGAGGGGAGTGGCAGG - Intronic
1149663847 17:58352267-58352289 GGCGGGGGTAGGGGCGGAGCTGG - Intronic
1149993543 17:61395826-61395848 GGCGGCGGTGGGGGAGTGGGGGG - Intergenic
1150216958 17:63476551-63476573 GCCGGGGGTAGGGGTGTGGCGGG - Intergenic
1150217122 17:63477006-63477028 GGCGGGGGCGGGGGTGTGTCGGG + Intergenic
1150218220 17:63481832-63481854 TGCTGGGGTAGGGTAGAGGCAGG - Intergenic
1150311181 17:64130288-64130310 GGCGGGGATGTGGGAGGGGCTGG + Intronic
1150433200 17:65135037-65135059 GGGGTGGGGAGGAGAGTGGCAGG + Intergenic
1150562020 17:66302682-66302704 GGCGGGGGCCGGGGAGAGTCGGG - Intronic
1150643398 17:66964417-66964439 GGCGCGGGGAGGGGAGGGGAAGG + Intergenic
1150823839 17:68457513-68457535 GGGCGGGGTAGGGGCGGGGCAGG - Intronic
1151309087 17:73282514-73282536 GGAGGTGGTAGGGCAGGGGCAGG + Intergenic
1151365546 17:73614077-73614099 GGCTGGGGAAGGGCAGGGGCCGG - Intronic
1151520983 17:74629328-74629350 GGAGGGGGGAGGGGAGGGGGAGG + Intergenic
1151525974 17:74668397-74668419 GGCGGGGGGGGGGGTGTGGGGGG - Intergenic
1151657506 17:75502699-75502721 GGCGGGTCTGGGGGAGTGGCAGG + Exonic
1151685242 17:75642395-75642417 GGCGGGGGTGTGGCAGGGGCTGG - Intronic
1151748594 17:76024433-76024455 GGCTCGGGGAGGGAAGTGGCAGG - Intronic
1151822806 17:76506289-76506311 AGAGGGAGCAGGGGAGTGGCTGG + Intergenic
1151842283 17:76627016-76627038 GGAGGGGGCAGGAGAGGGGCTGG + Intronic
1151982886 17:77524731-77524753 GGCTGGGGGAGGGGAGTGAGAGG - Intergenic
1152024563 17:77800299-77800321 GGCGGGGGGTGGGGGGTGGTGGG + Intergenic
1152185635 17:78854919-78854941 GGCGGGGGGGGGGGGGTGGGGGG + Exonic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152227071 17:79097521-79097543 GGCGGGGCTTGGGGAGGGGTTGG - Intronic
1152237455 17:79145911-79145933 GCCGGGGGCAGGGGGGTGGTTGG + Intronic
1152349682 17:79777909-79777931 GGCGGGGGTGGGGGCGCGGGCGG - Intergenic
1152378342 17:79929942-79929964 GGGGAGGGGAGGGGAGGGGCGGG - Intergenic
1152388995 17:79991894-79991916 GGCGGGGGTGGGGGGATGGTTGG + Intronic
1152625582 17:81386682-81386704 GGCGGGGGTAGGGGGTATGCCGG + Intergenic
1152637622 17:81436576-81436598 GGCGGGGGTAGGGGAGTGGCAGG - Intronic
1152703867 17:81833103-81833125 GCCGGGCGCGGGGGAGTGGCCGG - Intronic
1152728801 17:81960180-81960202 GTCGGGGGTCGGGGAGCGGCGGG - Intronic
1152752324 17:82068799-82068821 GGCGGAGGCAGGAGAATGGCGGG + Intergenic
1152756190 17:82088071-82088093 GGCGGGGGTAGCTGGGGGGCGGG - Intronic
1152773901 17:82187827-82187849 GGCGGGGGTGGGGGAGGCGTTGG + Intronic
1152789756 17:82272917-82272939 GGCGGGCCTGGGGGAGGGGCAGG - Intronic
1152793242 17:82293262-82293284 GGCGCGGGCAGGGGAGTGGAGGG + Intergenic
1152831102 17:82497442-82497464 GGCGGGGGTGGGAGGGAGGCCGG - Intergenic
1152861317 17:82698325-82698347 GGCAGGGGTCGGGAAGAGGCCGG - Intronic
1152864842 17:82716540-82716562 GGGGCGGGAAGGGGAGGGGCCGG - Intergenic
1152922514 17:83073093-83073115 GGCGGGGGTGGGGCAGGGCCTGG - Intergenic
1152932981 17:83119943-83119965 GGGAGGGGTTGGGGAGGGGCTGG + Intergenic
1152933027 17:83120030-83120052 GGGAGGGGTTGGGGAGGGGCTGG + Intergenic
1152933038 17:83120051-83120073 GGGGAGGGTTGGGGAGGGGCTGG + Intergenic
1152957155 18:49290-49312 GGTGGGGGTGGGAGAGCGGCTGG - Intronic
1153871945 18:9329933-9329955 GGCGGGGGTGGGGGGGTGGGGGG + Intergenic
1154153110 18:11922567-11922589 GGCTGAGGCAGGAGAGTGGCGGG - Intergenic
1154216414 18:12419826-12419848 GGCTGGGGCAGGAGAATGGCGGG + Intronic
1154310261 18:13261834-13261856 GGTGGGGGCGGGGGAGAGGCAGG + Intronic
1155053801 18:22168959-22168981 GGCGGGGGTTGGGGGGCGGGGGG + Intergenic
1155074461 18:22342539-22342561 GGCGGGGGTGGGGGGGAGGGGGG - Intergenic
1155243492 18:23885324-23885346 GGTGGGGGTGGGGGGGTGGGGGG - Intronic
1155707657 18:28837128-28837150 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
1156075649 18:33275658-33275680 GGAGGGGGGAGGGGAGGGGAGGG + Intronic
1156298894 18:35818118-35818140 GACGGGGGTAGGCTGGTGGCAGG + Intergenic
1156502324 18:37567371-37567393 TGCGCGGGAAAGGGAGTGGCAGG + Intergenic
1156698829 18:39799358-39799380 GGCGGGGGGCGGGGGGTGCCTGG + Intergenic
1156920902 18:42521612-42521634 GGGGTGGGGAGGGGAGGGGCAGG - Intergenic
1157040788 18:44036607-44036629 GGGGGGGGGGGGGGAGTCGCAGG - Intergenic
1157127517 18:44971013-44971035 GGTGGGGGAAGGGGAGAGGGGGG - Intronic
1157142462 18:45123403-45123425 GGCGGGGGCAGGGGGATGGGTGG + Intergenic
1157196877 18:45626792-45626814 GGTGGGGGTAGAGGGGAGGCTGG - Intronic
1157354293 18:46918428-46918450 TGCGGGGGCAGGGGAGTGGAAGG - Intronic
1157502699 18:48202472-48202494 GGTGGGGGGCGGGGGGTGGCTGG + Intronic
1157743665 18:50115820-50115842 GGAGGGGGGAGGGTAGTGGTAGG + Intronic
1157979316 18:52362783-52362805 GGAGGGAGGAGGGGAGTGGGGGG - Intronic
1158202228 18:54953996-54954018 GGCGAGGGGAGGGGAGGGGAAGG - Intronic
1158836139 18:61333666-61333688 AGAGGGGGTAGGGGGGTGGGGGG + Exonic
1158958841 18:62570265-62570287 GGCAGGGGTGGGGAAGTGGAGGG + Intronic
1160164288 18:76496132-76496154 GGCCGGGGTGGGGGAGGGGAGGG + Intronic
1160164304 18:76496161-76496183 CGCGGGGGCGGGGGAGGGGCGGG + Intronic
1160412262 18:78683166-78683188 GGCGGGAGTGGGGGTGTTGCGGG + Intergenic
1160499172 18:79394074-79394096 AGCGGAGGAAGGGGAGGGGCGGG + Intergenic
1160597678 18:79988463-79988485 GGCGGGGGCCGGGGAGTGAGGGG - Exonic
1160668421 19:344487-344509 GGCCGGGGTGGGGGAGGGGAGGG - Intronic
1160745100 19:707757-707779 GGTGGGGGCAGGGGGGTGGGGGG + Intergenic
1160773509 19:844219-844241 GGCGCGGGCGGGGGAGAGGCGGG - Intronic
1160779586 19:871889-871911 AGCGGGGAGAGGGGAGGGGCGGG + Intronic
1160828529 19:1091746-1091768 GGCTGGGGAGGGGGAGAGGCTGG + Intronic
1160859255 19:1230772-1230794 GGCGGGGGTGGGAGAGGGCCTGG + Exonic
1160966035 19:1747379-1747401 GGCGGGCGGTGGGGAGTGGCTGG - Intergenic
1160966041 19:1747396-1747418 GGCGGGCGGTGGGGGGTGGCGGG - Intergenic
1160975812 19:1791917-1791939 GGCGGGGGCAGGAGAGTCCCAGG + Intronic
1160994888 19:1877970-1877992 GGCGGGGGTAAGGGAGGCCCTGG + Intronic
1161016330 19:1985566-1985588 GGGGTGGGTGGGGGCGTGGCCGG + Exonic
1161093887 19:2377591-2377613 GGTAGGGGTAGGGGAGGGGGAGG - Intergenic
1161210358 19:3062421-3062443 GGCGGGCGGCGGGGAGGGGCGGG - Intronic
1161250438 19:3276870-3276892 GGCGGGGTCTGGGGAGGGGCGGG + Intronic
1161255491 19:3306794-3306816 GGCGGGGCTGGGGGCGGGGCTGG - Intergenic
1161279021 19:3435054-3435076 GGCGAGGGAAGGGGAGAGGCTGG - Intronic
1161317520 19:3624636-3624658 GGCGCGGGCAGGGAGGTGGCTGG + Intronic
1161352820 19:3803397-3803419 GGCGGCGGGACGGGAGTGGCAGG - Intergenic
1161397590 19:4052671-4052693 GGTGGGGGCAGGGGGCTGGCAGG - Intronic
1161437584 19:4273029-4273051 GGCAGGGATAGGGGAAGGGCAGG - Intergenic
1161438774 19:4279209-4279231 CGCAGGGGGAGGGGAGGGGCGGG + Exonic
1161451621 19:4349421-4349443 GGCGGGAGAAGGCGAGTGGGAGG + Intronic
1161476897 19:4491263-4491285 GGGGGGGGTGGGGGGGTGGGGGG - Intronic
1161495482 19:4583910-4583932 GGTGGGGGTAGGGGTGTGCGGGG + Intergenic
1161513455 19:4684015-4684037 GGCGGTGGTGGGGATGTGGCTGG - Intronic
1161590328 19:5126556-5126578 GGCGAGGGGAGGGGAAGGGCTGG - Intronic
1161635868 19:5388638-5388660 GGCGAGGGGAGGGGAGGGGAGGG + Intergenic
1161717593 19:5885633-5885655 CGTGGGGCTTGGGGAGTGGCTGG + Intronic
1161733640 19:5977628-5977650 GGCCGGGGAAGGGGAGATGCCGG + Intronic
1161786020 19:6326226-6326248 GGCTGAGGCAGGAGAGTGGCGGG - Intronic
1161821831 19:6534466-6534488 GCCGGGGGGCGGGGAATGGCGGG - Intronic
1161845711 19:6710868-6710890 GGCTGGGGAGGGTGAGTGGCAGG + Intronic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1162134081 19:8544548-8544570 GGAGGGGGTGGAGGAGTGGAGGG + Intronic
1162396460 19:10420452-10420474 GGCGGGGGGCGGGGAGGGGCGGG + Intronic
1162399414 19:10435855-10435877 GGTGGGGATAGGGGAGAGTCAGG - Intronic
1162403690 19:10461248-10461270 GGCGGGGCTGGGGGCGGGGCTGG + Intronic
1162403727 19:10461342-10461364 GGCGGGGCTGGGGGCGGGGCTGG + Intronic
1162463736 19:10829008-10829030 GGCAGGGGTTGGGGAGGGTCAGG - Intronic
1162491550 19:10995507-10995529 GGAGGGGGAAGTGGAGTGGAAGG + Intronic
1162560974 19:11418237-11418259 GGCGGGGGCGGGGGGGTGGGGGG - Intronic
1162561292 19:11419343-11419365 GGCGGGCGGCGGGCAGTGGCCGG + Intergenic
1162725870 19:12689482-12689504 GATGGAGGTAGGGGAGAGGCAGG + Intronic
1162802503 19:13118868-13118890 GGAGGGGGGCGGGGAGGGGCCGG + Intronic
1162809240 19:13154324-13154346 GGAGGGGGAAGGGGAGTGCCTGG - Exonic
1162893763 19:13752234-13752256 GGAAGGGGTAGGGGAGGGGGAGG - Intronic
1162905006 19:13818073-13818095 GGCGGGGCTAGGGGCGGGGCTGG - Intronic
1162952599 19:14080878-14080900 GGCGGGGGGAGGGGAGGGGAGGG + Intergenic
1162953976 19:14088390-14088412 GGCTGGGGCAGGGGTGAGGCTGG + Exonic
1162954611 19:14091053-14091075 GGGAGGGGGAGGGGAGTGCCGGG + Intergenic
1163096675 19:15063204-15063226 GGAGGGGGGAGGGGAGAGGGGGG - Intergenic
1163130136 19:15267330-15267352 GGTGGGGGGCTGGGAGTGGCAGG - Intronic
1163265016 19:16215198-16215220 GGCGGGGGGGGGGGAGAGGGGGG + Intronic
1163329291 19:16626915-16626937 TGCGGGGGTGGGGGGGTGGGGGG - Intronic
1163351209 19:16777569-16777591 GGAGGGGATAGGGGAGGGGAGGG + Intronic
1163370315 19:16897632-16897654 GGTGGGAGTCGGGGTGTGGCAGG + Intronic
1163529685 19:17842254-17842276 GGCGGGGCTCGGGGAGGGGCCGG - Intronic
1163547239 19:17947815-17947837 GGCGGGGGTGGGGGCGGGGCCGG - Intergenic
1163547322 19:17948102-17948124 GGCGGGGGGCGGGGGGTGTCGGG - Intergenic
1163684714 19:18704906-18704928 GGTGGGGGTTGGGGATTGGGGGG - Intronic
1163695068 19:18759933-18759955 GGCGGGGACAGGGGGCTGGCGGG - Intronic
1163725868 19:18922755-18922777 GGCGGTGGGAGGGGAGAGGCGGG - Intronic
1163729640 19:18941409-18941431 GGCGGTGGAGGGGGAGTGGGGGG + Intergenic
1163831556 19:19549545-19549567 GACGGGGCTAGGGAAGTGGTGGG - Intergenic
1163847682 19:19646651-19646673 GGAGGGGGTGGGAGATTGGCTGG - Intronic
1164398410 19:27886344-27886366 GGAAGGGGTAGTGGAGTGGGAGG - Intergenic
1164408866 19:27979937-27979959 GGCGGGGGGGGGGGGGGGGCGGG - Intergenic
1164462495 19:28461165-28461187 GGTGGGGGCAGGGGAGTGCTGGG - Intergenic
1164638798 19:29810820-29810842 GGCGGGGGGTGGGGGGTGGCAGG - Intergenic
1164678243 19:30117412-30117434 GGCGGGGGGAAGGGGGTAGCAGG + Intergenic
1164947618 19:32309764-32309786 GCCGGCGACAGGGGAGTGGCAGG - Intergenic
1165329691 19:35134667-35134689 GGTGGGGGCATGGGAGGGGCAGG - Exonic
1165405680 19:35629411-35629433 GGCGGGGATAGGGGAGAGGTTGG + Intronic
1165412462 19:35670494-35670516 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1165534065 19:36428641-36428663 GGCAGGGGATGGGGAGGGGCCGG + Intergenic
1165784656 19:38453809-38453831 GGCTTGGGTGGGGGAGTGGGAGG + Intronic
1165925006 19:39321103-39321125 GGCGGGGCTGGGGGTGGGGCTGG - Intergenic
1166105707 19:40597153-40597175 GGCGGGGGCAGGGGCGGGGCCGG + Intronic
1166268995 19:41701986-41702008 GGCTGAAGTAGGGGAGTGGTCGG + Intronic
1166294912 19:41884181-41884203 GGCGGGGCCCGGGGAGTGACGGG + Intronic
1166328893 19:42067532-42067554 GGCGGAGCTAGGAGAGAGGCAGG + Intronic
1166361090 19:42253405-42253427 GGCTGGGGGAGGGGAGGGGAAGG - Intronic
1166367157 19:42283800-42283822 GGCCGCGGTAGGAGGGTGGCAGG - Intronic
1166610562 19:44190432-44190454 GGCTGAGGTAGGAGAATGGCAGG - Intergenic
1166627999 19:44378187-44378209 GGCGGGGGGAGGGGGGAGGGGGG + Intronic
1166661099 19:44647731-44647753 GGTGGGGGGAGGTGAGTGGGGGG + Intronic
1166691063 19:44821338-44821360 GGCGGAGGTAGGGCGGGGGCAGG - Exonic
1166746875 19:45145821-45145843 GGAGGGGGTGGGGGAGAGGGAGG - Exonic
1166811623 19:45517876-45517898 GGCGGGCGCAGGGGTGGGGCGGG - Intronic
1166822901 19:45591485-45591507 GGCGGGCGAAGCGGAGTGGGTGG + Exonic
1166888108 19:45973568-45973590 GGCGGGGGAGGGGGAGGGGAGGG + Intergenic
1166948047 19:46409160-46409182 GGAGAGGGGAGGGGAGTGGAGGG + Intergenic
1166948058 19:46409189-46409211 GGAGAGGGGAGGGGAGTGGAGGG + Intergenic
1167019046 19:46860977-46860999 GGCGGGGGGCGGGGAGGGGAAGG - Intergenic
1167103942 19:47419643-47419665 GGTGGGAGTCGGGGAGGGGCAGG + Intergenic
1167237493 19:48323736-48323758 CGCTGGGGTTGGGGAGTGGTGGG - Intronic
1167269332 19:48498799-48498821 GGCGGGGGGGGGGGAGCGGGAGG + Exonic
1167278813 19:48554420-48554442 GGTGGGGGTTGGGGACTGACAGG - Intronic
1167379990 19:49133200-49133222 GGCAGGGGGAGGGGACGGGCTGG - Intronic
1167383014 19:49149423-49149445 GGCGGGGCCAGGAGAGGGGCGGG + Intronic
1167390265 19:49190285-49190307 GGCGGGTGTAGATGAGTGGAGGG - Exonic
1167465876 19:49651005-49651027 GGTGGGGGTGGGGGAGGGGAAGG - Exonic
1167486651 19:49766941-49766963 CGCGGGCGGAGGGGAGGGGCAGG + Intergenic
1167504092 19:49862336-49862358 GGCGGGGGTGGGGGTGGGGATGG - Intronic
1167596679 19:50432008-50432030 GGCGGGGCCTGGGGAGGGGCGGG - Intergenic
1167623268 19:50570142-50570164 GGCGAGGGCCAGGGAGTGGCAGG + Intergenic
1167738672 19:51311698-51311720 GGCGGGGGGAGGGGGCTGGGGGG - Intergenic
1167743874 19:51339980-51340002 AGCGGGAGTAGGGGAATGCCTGG - Intronic
1167967502 19:53159098-53159120 GGCGGGGCCTGGGGAGAGGCGGG + Intergenic
1168146890 19:54424596-54424618 GGCGAGGGCAGGGAAGTGGTGGG + Intronic
1168162143 19:54517961-54517983 GTCGGGGGTGGGGGAGGGGGAGG + Intergenic
1168165292 19:54543107-54543129 GGTGGAGGTAGGGGAGGGGTTGG - Intronic
1168258602 19:55180355-55180377 GGCGGGAGGAGGGGCGGGGCAGG - Exonic
1168260610 19:55191944-55191966 GGAGGAGGTAGGAGAGGGGCTGG - Intronic
1168350701 19:55674224-55674246 GGCGGGGGTTGGGGGGTTGGGGG + Exonic
1168602011 19:57726076-57726098 GGTGGGGGCGGGGGAGTGGGGGG - Intronic
1168642079 19:58037481-58037503 GGGGTGGGAAGGGGAGGGGCTGG + Intronic
1168719162 19:58545298-58545320 GGCTCGGGGAGGGGAGGGGCTGG + Intronic
1202696900 1_KI270712v1_random:132295-132317 GGCGGGCGTCGGGAAGTGACAGG + Intergenic
925032142 2:659209-659231 GAGGGGGGTAGGGGAGTCGGTGG + Intergenic
925069613 2:956219-956241 GGCAGGGGTGGGGCAGGGGCGGG - Intronic
925156542 2:1652581-1652603 GGCGGGGGTGGGGGCAGGGCAGG - Intronic
925169725 2:1743602-1743624 GGCGGGGGAGGGGGAGAGGGCGG + Intronic
925361835 2:3285313-3285335 GGTGGGGGTGGGGGGGTGGGAGG - Intronic
925418380 2:3690281-3690303 GGAGGGGGGAGGGGAGGGGGAGG - Intronic
925418395 2:3690304-3690326 GGAGGGGGGAGGGGAGGGGGAGG - Intronic
925418438 2:3690371-3690393 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
925418449 2:3690388-3690410 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
925420302 2:3704707-3704729 GGAGGGGGGAGGGGCGTGGGGGG + Intronic
925755387 2:7128079-7128101 GGAGGGGGAAGGGGAGGGGAGGG - Intergenic
925927637 2:8681783-8681805 GGCGGGGGGCGGGGAGCGGCGGG - Intronic
926683585 2:15681146-15681168 GGAGGGGGGAGGGGAGGGGGAGG + Intergenic
926683620 2:15681199-15681221 GGAGGGGGTGGGGGAGGGGGAGG + Intergenic
926720539 2:15957146-15957168 GGTGGGGGTAGGGGGTTGGAGGG - Intergenic
927232171 2:20834663-20834685 GGAGGGGGAAGGGGAGGGGGAGG - Intergenic
927424938 2:22971102-22971124 GGGGGGGGTGGGGGGGGGGCAGG + Intergenic
927492625 2:23530722-23530744 GGCGGGGGCAGGGGATGGGCTGG - Intronic
927586293 2:24308899-24308921 AGCGGGGCTCGGTGAGTGGCAGG + Intronic
927606596 2:24491592-24491614 GGCGGCGGCAGGTGAGTGGCGGG + Intergenic
927920882 2:26971003-26971025 GGAAGGGGAGGGGGAGTGGCTGG - Intronic
928092969 2:28387337-28387359 GGTGGGGGTGGGGGAGGGGGCGG - Intergenic
928149143 2:28810697-28810719 GGCGGGGGGCAGGGAGGGGCGGG + Intronic
928169413 2:28993782-28993804 GGCCTGGGTGGGGCAGTGGCTGG + Intronic
928193411 2:29194656-29194678 AGCGGGGGTGGGGGGGTGGGGGG - Intronic
928201560 2:29250626-29250648 GGCTGGGGTAGGGTTGGGGCTGG + Intronic
928313738 2:30231114-30231136 GGCTGGGGTGGAGGAGTGGCGGG + Intergenic
928352169 2:30568606-30568628 GGCTGAGGCAGGGGAATGGCGGG - Intronic
928602461 2:32916233-32916255 GGGGGGGGTGGGGGGGGGGCGGG + Intergenic
928698664 2:33876464-33876486 GGCGGAGGCAGGAGAATGGCGGG + Intergenic
928700476 2:33894032-33894054 GGGGAGGGAAGGGGAGTGGGAGG - Intergenic
928928045 2:36598118-36598140 GGCGGCGGACGGGGACTGGCAGG - Exonic
929031864 2:37656984-37657006 GGCGGGGGGCGGGGGGTGGGGGG - Intronic
929440715 2:41964203-41964225 GGATGGGGTGGGGGAGGGGCAGG - Intergenic
929444594 2:41992190-41992212 GGAGAGGGTAGGGGAGAGGAGGG + Intergenic
929606245 2:43236142-43236164 GGAAGGGGCAGGAGAGTGGCGGG + Intronic
929857724 2:45650754-45650776 GCCGGGGATGGGGGAGTGGAGGG - Intergenic
929949302 2:46393947-46393969 GGGGGGGGGGGGGGAGGGGCAGG + Intergenic
929955700 2:46456896-46456918 GGAGGAGGAAGGGCAGTGGCTGG - Intronic
930308948 2:49713965-49713987 GACGGGGGAAGGGAAGTGGTAGG + Intergenic
930639519 2:53840588-53840610 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
930639540 2:53840625-53840647 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
930639544 2:53840635-53840657 GGGGAGGGGAGGGGAGTGGAGGG + Intergenic
930639555 2:53840652-53840674 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
930969512 2:57377748-57377770 GGGGAGGGCAGGGGAGGGGCAGG + Intergenic
931014432 2:57960058-57960080 GGCGGGGGGAGGTGTGTGACGGG + Intronic
931140509 2:59452802-59452824 GGCTGAGGTAGGAGAATGGCAGG - Intergenic
931277493 2:60756509-60756531 GGCGGCGGTTGGGGTGAGGCGGG + Intronic
931348893 2:61470965-61470987 GACGGGGGGAGGGGAGAGGGGGG + Intergenic
931429321 2:62196464-62196486 GGCGGGGGTAGCAGGGTGTCCGG - Intronic
931601440 2:64007301-64007323 GGAGGTGGTAGGGGAGTGACTGG + Intronic
931681220 2:64751206-64751228 GGCGGGGGCAGTGGAGTGGGGGG + Intergenic
931696725 2:64876490-64876512 GGAGGAGGCTGGGGAGTGGCAGG - Intergenic
932231528 2:70087659-70087681 GGCGGGGGGAGGGGAGGTGTAGG - Exonic
932716286 2:74102349-74102371 AGTGGGGGTAAGGGAGGGGCGGG - Exonic
932773514 2:74514399-74514421 GCTGGGGGTAGGGCAGGGGCGGG - Intronic
933117868 2:78497591-78497613 TGTGGGGGTTGGGGGGTGGCGGG - Intergenic
933131844 2:78681918-78681940 GGTGGGGAGAGGGGAGTGGGTGG - Intergenic
933555545 2:83826235-83826257 GGTGGGGATTGGGGAGGGGCAGG - Intergenic
933666809 2:84971103-84971125 GGCCGGGGGAGGGGAGGAGCGGG + Exonic
933774828 2:85765685-85765707 TGCGGGGGTAGGGCAGTGAGGGG - Intronic
934033049 2:88065224-88065246 GGAGGGGGGAGGGGAGGGGAGGG - Intergenic
934033072 2:88065259-88065281 GGGGGGGGGAGGGGAGGGGAGGG - Intergenic
934278060 2:91589309-91589331 GGCGGGCGTCGGGAAGTGACAGG + Intergenic
934708995 2:96503150-96503172 GGAGGGAGTAGGGAACTGGCTGG + Intronic
934745821 2:96759092-96759114 GGTGGGGGTAGGGGTGGAGCAGG + Intergenic
934810041 2:97269996-97270018 GGAGGGGGTGGGGTGGTGGCTGG - Intergenic
934827651 2:97437943-97437965 GGAGGGGGTGGGGTGGTGGCTGG + Intergenic
934980294 2:98833854-98833876 GCCCAGGGTAGGGGAGTGGCAGG - Intronic
935165475 2:100565373-100565395 GGCTGAGGCAGGAGAGTGGCAGG - Intronic
935292562 2:101622526-101622548 GGCGGGGGGCGGTGGGTGGCAGG - Intergenic
935303910 2:101718562-101718584 GGTGGGGGTGGGGGGGTGGGGGG + Intronic
936225544 2:110646354-110646376 GGGGAGGGGAGGGGAGGGGCGGG + Intronic
936713727 2:115161815-115161837 GGTGGGGGGAGCGGAGGGGCGGG - Exonic
936722691 2:115272739-115272761 TGCGTGGGCAGGGGAGGGGCTGG - Intronic
936740555 2:115501657-115501679 GCAGGGGTTAGGGGAGTGGAAGG + Intronic
936972043 2:118185581-118185603 GGCGGGGGGAGAGGTGGGGCAGG + Intergenic
937110885 2:119366679-119366701 CGCGGGGGAAGGGGAGGGGACGG - Exonic
937190621 2:120093985-120094007 GGTGGGGGTAGGGGACGTGCAGG + Intronic
937274538 2:120675395-120675417 GGCGGGTGCAGGGGAGTGGAGGG + Intergenic
937294060 2:120799176-120799198 GGCGGGAGTAGGGGCCAGGCAGG + Intronic
937413410 2:121696150-121696172 GTCTGTGGTGGGGGAGTGGCAGG + Intergenic
938289090 2:130140103-130140125 GGCAGGGGCAGGGGCGTGGTGGG + Intronic
938407569 2:131040929-131040951 GGCGGTGGTAGGGGGTTGGGTGG - Intronic
938610768 2:132945283-132945305 GGCGGGGGCAGGGGTGGGGTGGG + Intronic
938657819 2:133452548-133452570 GGAGGCAGTAGGGGAGAGGCAGG + Intronic
938669238 2:133571360-133571382 GGTGGGGGTAGGGGAGGGAAAGG + Intergenic
938783220 2:134603834-134603856 GGTGGGGGAAGGGGAGGGGAGGG + Intronic
938982385 2:136539053-136539075 GGCCGGGGGAGGGGAGGGGGCGG - Intergenic
939778390 2:146413502-146413524 AGCGGGGGAAGGGGAGTGCTTGG - Intergenic
939787675 2:146537404-146537426 GGGGAGGGTAGGGGAGGGGAGGG + Intergenic
940130020 2:150370267-150370289 GGCCGGGGCAGGGGAGTCACTGG + Intergenic
940145666 2:150542481-150542503 GGGGGGGGCCGGGGAGAGGCGGG + Intergenic
940265173 2:151828490-151828512 GGCGGGGGAAGTGAAGGGGCGGG + Intronic
940830176 2:158457408-158457430 GCCGGGGGGAGGGGAGCAGCAGG - Intronic
940945655 2:159615479-159615501 AGCGGGGGTGGGGGTGGGGCAGG - Intronic
941058289 2:160813988-160814010 GGTGGGGGTGGGGGGGTGGGGGG - Intergenic
941897267 2:170641859-170641881 GGGGGGGGGGGGGGAGGGGCGGG + Intronic
942046645 2:172102800-172102822 GGCGGGGGGCGGGCAGTGGAGGG + Exonic
942138178 2:172950234-172950256 GAGGGCGGTAGGGGAGGGGCTGG + Intronic
942240987 2:173964274-173964296 GGCGGGGGGAGGGGAGTGGAGGG + Intronic
942276740 2:174328562-174328584 GGCGGGGGTGGGGGTGGGGGCGG + Intergenic
942807296 2:179946468-179946490 GGGGGGGGAAGGGGAGGGGAGGG + Intronic
942890500 2:180981021-180981043 GGCGGCGGTGGGGGAGGGGGCGG + Intronic
942911023 2:181244774-181244796 GGCGGGGGTTGGGGGCGGGCGGG - Intergenic
942940167 2:181606517-181606539 GGAGAGGGTAGGGGAGAGGAGGG + Intronic
943406975 2:187501286-187501308 GGCGGGGGGAGGGAAGGGGAAGG - Intronic
943464891 2:188217521-188217543 GGAGGGGGGAGGGGAGGGGAGGG - Intergenic
943637452 2:190321804-190321826 GGCGGGGGTTGGGGTGGGGAAGG - Intronic
943821187 2:192323654-192323676 GGATGGGGTTGGGGAGTGGCGGG + Intergenic
943838984 2:192552919-192552941 GGGTGGGGTAGGGGAGTGCTGGG - Intergenic
944060134 2:195563269-195563291 GGCGGGGGGGGCGGAGGGGCCGG - Intergenic
944076363 2:195735824-195735846 GGCGGGGGTAGGTGAGGGTTTGG + Exonic
944091414 2:195916431-195916453 GGCAGGGGTGGGGGGGTGGGAGG - Intronic
944543674 2:200778475-200778497 GGAGGGGATAGGGCTGTGGCAGG - Intergenic
945305271 2:208254304-208254326 GGGGAGGGGAGGGGAGGGGCGGG - Exonic
945862581 2:215140552-215140574 GCCGGGGGTGGGGGTGTGGTGGG - Intergenic
946029234 2:216691933-216691955 GGCGGGGGTGGGGGAGAGGAGGG + Intronic
946310200 2:218879070-218879092 GGTGGGGGTGGGGCAGTGGGGGG - Intergenic
946381298 2:219350878-219350900 GGTGGGGGAAGGGGAGAGGGAGG - Intergenic
946649467 2:221875239-221875261 GATGGGGGTAGGGGAGTAGGAGG - Intergenic
946830838 2:223726637-223726659 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
947217619 2:227763642-227763664 GGCGGGGGTGGGGGTGGGGTGGG + Intergenic
947532830 2:230923616-230923638 GGCTGGGAGAGGGGAGGGGCCGG + Intronic
947592871 2:231395424-231395446 GGCGGGGGGAGGGCGGTCGCCGG - Intergenic
947792467 2:232876116-232876138 GGCGGCGGTACGGGCGGGGCGGG + Exonic
947796426 2:232896655-232896677 GGTGGGGGTAGGGGTGGGGGTGG + Intronic
947931413 2:233968213-233968235 GGAGGGGGTGCGGGGGTGGCGGG - Intronic
948122691 2:235543089-235543111 GGCGGGGGGGGGGGAGGGGGAGG - Intronic
948170566 2:235898474-235898496 GGCGGGGGTGGGGGTGGGGGGGG - Intronic
948428954 2:237906403-237906425 GGCGGGGGTAGAGGGGTGCTGGG + Intronic
948524270 2:238560538-238560560 TGCTGGGGTTGGGGCGTGGCAGG + Intergenic
948578252 2:238967790-238967812 GGCGGTGCTAGGCGAGTGGGCGG - Intergenic
948796057 2:240402569-240402591 GTCTGGGGTCGGGGTGTGGCTGG - Intergenic
948988695 2:241541210-241541232 GGCGGGGCCAGGCGAGGGGCGGG + Intergenic
1168883395 20:1226010-1226032 GGCGCGGGGCGGGGAGGGGCGGG - Intergenic
1168972853 20:1942679-1942701 GGCCGGGGGTGGGGAGGGGCAGG - Intergenic
1169131521 20:3168343-3168365 GGAGGGGGGAGGGGAGGGGAGGG + Intronic
1169164126 20:3407701-3407723 GGCGGGGGCGGGGGCGTGGAGGG + Intergenic
1169171302 20:3467943-3467965 GGTGGGGGTGGGGGTGGGGCCGG + Intergenic
1169327306 20:4686540-4686562 GGCGGGGGCAGGGGAGCCGCGGG + Intronic
1169473674 20:5911303-5911325 AGCGGGGGTGGGGGAAAGGCGGG - Intergenic
1170771475 20:19336680-19336702 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
1170876416 20:20254102-20254124 GGGGAGGGGAGGGGAGTGGAGGG - Intronic
1170970002 20:21106524-21106546 CGCGGGGGTCGGGGTGTGTCTGG + Intergenic
1170989335 20:21287551-21287573 GGGGGGGGTGGGGGGGTGGGTGG + Intergenic
1171122602 20:22579488-22579510 GGCGGGAGGGGGGCAGTGGCGGG + Intergenic
1171379546 20:24724041-24724063 GGCTGGGGCAGGAGAGTGGCAGG + Intergenic
1171421395 20:25020274-25020296 GGCGGGGGTGGGGGGTTGGGGGG - Intronic
1171460073 20:25293128-25293150 GGGGGGGGTGGGGGAGTGGGGGG + Intronic
1171866087 20:30488391-30488413 GGCGGTGGTGGGGGAGCCGCAGG - Intergenic
1172037004 20:32018177-32018199 GGCGGGGGCGGGGGAGGGGCGGG + Intronic
1172037019 20:32018200-32018222 GGCGGGGGCGGGGGAGGGGCGGG + Intronic
1172037029 20:32018217-32018239 GGCGGGGGCGGGGGCGGGGCAGG + Intronic
1172037032 20:32018223-32018245 GGCGGGGGCGGGGCAGGGGCAGG + Intronic
1172245690 20:33443724-33443746 GGCCGGGGTAGGGTGGCGGCTGG - Exonic
1172292061 20:33783894-33783916 GGGAGGGGGAGGGGAGGGGCTGG - Intronic
1172301546 20:33853745-33853767 GGCGGGGGGAGGGGGGCGGGCGG + Exonic
1172408100 20:34704191-34704213 GGGGAGGGGAGGGGAGGGGCAGG + Intronic
1172504186 20:35449108-35449130 GGCAGGGGTGGGGTGGTGGCGGG - Intronic
1172644488 20:36461405-36461427 CGCGGGGGGCGGGGAGGGGCGGG + Intronic
1172771833 20:37386601-37386623 GGAGGGGGGAGGGGAGAAGCTGG - Intronic
1172821648 20:37740861-37740883 GGATGGGGTAGCGGGGTGGCTGG - Intronic
1172867888 20:38113667-38113689 GGCGGGGTTAGGGGAAAGGGAGG + Intronic
1173082874 20:39886626-39886648 GGCAGGAGTAGGGGAGAGGGAGG - Intergenic
1173352470 20:42257637-42257659 GGCGGGGGGGGGGGGGTGGGGGG - Intronic
1173510597 20:43625179-43625201 TACTGGGGTAGGGGAGTGCCAGG + Intronic
1173627263 20:44482375-44482397 GGTGGGGGTTGGGGGGAGGCGGG - Intronic
1173741471 20:45405665-45405687 GGTGCGGGGAGGGGAGTGGGGGG - Intronic
1173815589 20:45985722-45985744 GGAGGAGGTAGGGGAATGGAAGG + Intergenic
1173816593 20:45993329-45993351 GGCGAGGGGAGGGGAGGGGAGGG + Intergenic
1173852398 20:46227449-46227471 GGCGGGGCCAGGGGCGGGGCGGG - Intronic
1174022396 20:47541399-47541421 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
1174036608 20:47672443-47672465 GGGGGTGGCAGGGGAGAGGCGGG - Intronic
1174137549 20:48391019-48391041 GGAGGGGGTAGGGGAGAGGAGGG + Intergenic
1174336117 20:49862065-49862087 GGTGGGGGTGGGACAGTGGCAGG - Intronic
1174338737 20:49883009-49883031 GGTGGGGGGAGGGGGGTGGGGGG - Intronic
1174385725 20:50187607-50187629 GGTGGGGGTGGGGGAGCAGCAGG + Intergenic
1174421984 20:50405275-50405297 GGCGGGAGAAGGGCAGAGGCTGG - Intergenic
1174456050 20:50649577-50649599 GGTGGGGGTGGGGGACAGGCAGG - Intronic
1174546407 20:51328564-51328586 GGAGGGGGAAGCGAAGTGGCAGG - Intergenic
1174801100 20:53563664-53563686 GGCTGGGGAAGGGGAGGGGAAGG - Intergenic
1174960514 20:55151755-55151777 GGAGGGGGGAGGGGAGGGGGAGG - Intergenic
1175290036 20:57869595-57869617 GGGAGGGAGAGGGGAGTGGCAGG - Intergenic
1175736089 20:61388272-61388294 GGTGGGGGTAGGGGGGTGTGGGG + Intronic
1175822193 20:61916188-61916210 GGGAGGGGTTGGGGAGTGGCGGG + Intronic
1175828719 20:61950848-61950870 GGCTGGGGAAGGGGAGAGGGTGG - Intergenic
1175828791 20:61951019-61951041 GGCTGGGGAAGGGGAGAGGGTGG - Intergenic
1175828827 20:61951112-61951134 GGCTGGGGGAGGGGAGAGGGTGG - Intergenic
1175828846 20:61951147-61951169 GGCTGGGGGAGGGGAGAGGGTGG - Intergenic
1175898784 20:62351867-62351889 GGCGGGGGAGGGGGACTGGCCGG - Intronic
1175901398 20:62361260-62361282 GGCAGGGCTAGGGGCCTGGCAGG + Intronic
1175927932 20:62480111-62480133 GGCAGGTGTTGGGGGGTGGCTGG + Intergenic
1175927946 20:62480144-62480166 GGCAGGTGTTGGGGGGTGGCTGG + Intergenic
1176085593 20:63294154-63294176 TGCGGGGGGAGGGGAGTGCGGGG + Intronic
1176092677 20:63325932-63325954 AGGGTGGGTGGGGGAGTGGCTGG + Intronic
1176094242 20:63332663-63332685 GGCGGGGGTAGGGCAGCTGAGGG - Intronic
1176127923 20:63484237-63484259 GGTGGGGGTAGGGGGGTGGGGGG - Intergenic
1176141075 20:63545368-63545390 CCCTGGGGCAGGGGAGTGGCAGG - Intronic
1176156950 20:63626829-63626851 GGCGGGGGGAGGGGAGGGCCGGG - Intronic
1176179446 20:63742535-63742557 GGCGGGGGCAGGGGCGGGGCAGG - Exonic
1176304699 21:5117294-5117316 GGTGAGGGTGGGGGAGGGGCCGG - Intronic
1176417241 21:6483815-6483837 TGGTGGAGTAGGGGAGTGGCTGG - Intergenic
1176422234 21:6525470-6525492 GGCTGAGGTGGGGGTGTGGCAGG + Intergenic
1176513677 21:7767396-7767418 GGAGGGGGCAGGGGAGAGGGAGG - Intronic
1176515531 21:7780776-7780798 GCTGGGGGCAGGGGAGTGGGTGG - Intergenic
1176670364 21:9728401-9728423 GGAGGGGGAAGGGGAGTGTGAGG + Intergenic
1177188123 21:17819693-17819715 GGCGGGGGTAGGAAAGCCGCGGG + Intergenic
1177350819 21:19939074-19939096 GGCGGAGGCAGGGGAATTGCTGG - Intergenic
1178414516 21:32393054-32393076 GGCGGGGCTCGGGGAAAGGCCGG + Intergenic
1178480741 21:32977616-32977638 GGCGGGGGTAGGGTTGTGGGGGG - Intergenic
1178621489 21:34180837-34180859 GGCGGGGGTGGGGGTGGGGAGGG + Intergenic
1178647790 21:34397920-34397942 GGAGGGGGCAGGGGAGAGGGAGG - Intronic
1178649559 21:34410788-34410810 GCTGGGGGCAGGGGAGTGGGTGG - Intergenic
1179095881 21:38314105-38314127 GATGGGGGAAGGGGTGTGGCAGG - Intergenic
1179175482 21:39005060-39005082 GGCGGGGGGGGGGGGGAGGCGGG + Intergenic
1179430327 21:41316920-41316942 GGCGAGGGTAGGGGCGGGGAAGG + Intronic
1179692738 21:43092148-43092170 TGGTGGAGTAGGGGAGTGGCTGG - Intergenic
1179697725 21:43133786-43133808 GGCTGAGGTGGGGGTGTGGCAGG + Intergenic
1179829279 21:43986018-43986040 GGCGGAGTCAGGGGTGTGGCCGG - Exonic
1179852355 21:44144736-44144758 GGTGAGGGTGGGGGAGGGGCCGG + Intronic
1179999518 21:44989055-44989077 GGCAGGGGCAGGGAGGTGGCCGG - Intergenic
1180056131 21:45360080-45360102 GGCCGGGGAAGGGGGTTGGCGGG - Intergenic
1180058841 21:45374530-45374552 GGAGGAGGCAGGGGAGGGGCAGG - Intergenic
1180147243 21:45928360-45928382 GCCAGGGGTTGGGGAGGGGCAGG + Intronic
1180156675 21:45981638-45981660 GGGGAGGGGAGGGGAGGGGCGGG - Intergenic
1180161556 21:46000625-46000647 GGCCGGGGAAGGGGGGAGGCCGG + Intronic
1180312801 22:11253265-11253287 GGCGGTGGTGGGGGAGCCGCAGG - Intergenic
1180649903 22:17369347-17369369 GGCGGGGGTGGGGCGGGGGCGGG + Exonic
1180876206 22:19176401-19176423 GGCGTGAGTGGGGGAGGGGCAGG - Exonic
1180918466 22:19505931-19505953 GGAGGGGCTGGGGGACTGGCTGG + Intronic
1181057852 22:20268311-20268333 CGCGGGGGTTGGGGCGTGGGCGG + Exonic
1181108376 22:20587753-20587775 GGCAGGGGCAGGGGTGTGGTGGG + Intergenic
1181113083 22:20613179-20613201 GGAGGAGGTGGGGGAGTGGGGGG + Intergenic
1181120946 22:20668504-20668526 GGCAGGGGTAGGGGAGGCCCTGG + Intergenic
1181178065 22:21048888-21048910 GGCAGAAGTAGGGGAGTGCCTGG + Intronic
1181333912 22:22115530-22115552 GGCGGGGGTAGGGGAGGCCCTGG + Intergenic
1181455591 22:23058629-23058651 GGCTGAGGTTGGGGAGTGACTGG - Intergenic
1181544213 22:23591923-23591945 GGCTGGGGGAGGGGTGTGGAGGG + Intergenic
1181569111 22:23757617-23757639 GGGGAGGGGAGGGGAGGGGCAGG - Intergenic
1181590913 22:23884233-23884255 GGCTGGGGTCGGGGAGAGGCAGG + Intronic
1181690152 22:24554829-24554851 GGCGGGTGTGGGGGCGAGGCGGG + Intronic
1181741721 22:24926327-24926349 GGTGGGGGTAGGGTAGGAGCTGG - Intronic
1181876688 22:25945782-25945804 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1181876701 22:25945807-25945829 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1181876717 22:25945837-25945859 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1181876730 22:25945862-25945884 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1182103316 22:27672127-27672149 GGAGGGGGGAGGGGAGGGGGAGG + Intergenic
1182351927 22:29704305-29704327 GGTGGGGGGAGGGGAGGGGAGGG - Intergenic
1182679827 22:32070214-32070236 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
1182830292 22:33299566-33299588 GGCGGGGGTTGGGTTGGGGCAGG + Intronic
1182915903 22:34030344-34030366 GGGGAGGGGAGGGGAGTGGAGGG - Intergenic
1183246204 22:36695478-36695500 GGTGGGGGTGGGGGAGTGGCAGG - Intronic
1183290591 22:36999562-36999584 GGAGGGGGGAGGGGAGGGGAGGG + Intronic
1183354859 22:37352714-37352736 GGCTGGGGCAGGAAAGTGGCAGG + Intergenic
1183438126 22:37807104-37807126 GGAGGGGGAGGGGGAGTGGGCGG + Exonic
1183472483 22:38016998-38017020 GGCTGGGGTGGGGGGCTGGCTGG - Intronic
1183585300 22:38749937-38749959 GGTGGGGGTGGGGTAGGGGCAGG - Intronic
1183642686 22:39101694-39101716 GCAGGGGGTGGGGGGGTGGCGGG + Intronic
1183815152 22:40293622-40293644 GAGGGGGGTAGGGGAATGGTGGG + Intronic
1183929433 22:41227640-41227662 GGCGGGGCTGGAGGAGGGGCCGG - Intronic
1184034886 22:41913671-41913693 TGTGGGGGCAGGGGAGAGGCAGG + Intronic
1184089382 22:42284197-42284219 GAGGGGGGCAGGGGAGGGGCGGG + Intronic
1184148350 22:42624460-42624482 GGTGGGGGTGGGGGAGCCGCAGG - Intronic
1184210868 22:43034916-43034938 GGAGGGGGGAGGGGAGGGGTGGG + Intergenic
1184402047 22:44280061-44280083 GATGGGGGATGGGGAGTGGCTGG - Intronic
1184431289 22:44442706-44442728 GGCTGGGGGAGGGCAGGGGCTGG - Intergenic
1184439197 22:44498239-44498261 GGCCGGGGCAGGGGCGGGGCCGG + Exonic
1184545613 22:45164752-45164774 GCCGGAGGTAGGGGGCTGGCAGG + Intronic
1184714682 22:46274107-46274129 GGCTGAGCTGGGGGAGTGGCAGG + Intronic
1184796989 22:46738330-46738352 GGCGTGGGTAGAGGAGGGGCCGG + Intergenic
1185245890 22:49772616-49772638 GGAGGGGCTGGGGGAGTGCCTGG - Intergenic
1185279149 22:49962507-49962529 GGGGGGGCTGGGGGAGGGGCCGG - Intronic
1185294159 22:50045224-50045246 GGCCGGGGCAGGGCAGTGCCAGG - Intronic
1185315657 22:50178190-50178212 GGCGGGGGCAGGGGCGGGGCCGG - Exonic
1185339026 22:50283470-50283492 GGGGTGGGTCGGGGAGTGCCTGG - Intronic
1185380210 22:50504492-50504514 GGGGTGGGGAGGGGAGGGGCAGG - Intronic
1185391076 22:50562156-50562178 GGCGGGGTGAGGGGTGAGGCGGG + Intronic
1185391082 22:50562173-50562195 GGCGGGGTGAGGGGTGAGGCTGG + Intronic
1185391161 22:50562394-50562416 GGCGGGGTGAGGGGTGAGGCGGG + Intronic
1185391168 22:50562411-50562433 GGCGGGGTGAGGGGTGAGGCGGG + Intronic
1185391231 22:50562570-50562592 GGCGGGGTGAGGGGTGAGGCGGG + Intronic
1185409569 22:50674750-50674772 GGCGGGGGTGGGGGAATCCCGGG - Intergenic
949131410 3:506287-506309 AGCGGGGGTAGGGGGGTGGTGGG - Intergenic
949847185 3:8383623-8383645 GGCAGGGGAAGTGGAGTGACAGG + Intergenic
949932435 3:9089290-9089312 GGCGGGGGGGGGGGGGGGGCTGG + Intronic
950113086 3:10432931-10432953 GGCTGGGGTAGGGGATGGGCTGG + Intronic
950548543 3:13653135-13653157 GGCCGGGGTTGGGGGTTGGCAGG + Intergenic
950728209 3:14933305-14933327 GGCAAGGGCAGGGGAGTGGTGGG - Exonic
950857365 3:16118561-16118583 GGCGGGGGTGGGGCAGTGCAGGG - Intergenic
952784249 3:37136957-37136979 GGGGGGGGTGGGGGGGTGGGGGG + Intronic
953493486 3:43368173-43368195 GGCTTGGGGAGGGGACTGGCTGG + Intronic
953571769 3:44076731-44076753 GGTGGGGGGAGGGGAGTCGGGGG + Intergenic
953671364 3:44964976-44964998 GGCGGGGGTAAGGAAGTCACAGG + Intronic
953886222 3:46715739-46715761 GGCTGGGGGAGGGGAGGGACAGG - Intronic
953995586 3:47517068-47517090 GGCTGGGGTAGGAGAATTGCTGG - Intergenic
954156913 3:48690476-48690498 GGGGAGGGGAGGGGAGGGGCAGG + Intronic
954333249 3:49901940-49901962 GGCGGGGGTGGGGGAGGGGAGGG + Intronic
954380338 3:50215831-50215853 GGCGTGGGGAGGGGAGGGGAGGG + Intronic
954397550 3:50300943-50300965 GGTGGGGGTGGGGGAGGGGTGGG - Intronic
954411861 3:50374345-50374367 GGAGGGGGAAGGGGAGGGGAGGG + Intronic
954469172 3:50676710-50676732 GGCGGGGGTGGGGGCGTGGGGGG + Intronic
954713615 3:52516605-52516627 GGGGCGGGTGGGTGAGTGGCGGG + Intronic
954796071 3:53161858-53161880 GGCGGGGGTAGGGGTGTGGGTGG - Intronic
955098362 3:55822712-55822734 GGCTGAGGTAGGAGAGTGGCGGG - Intronic
955202316 3:56862158-56862180 GGCAGGGTGAGGGGAGTGGGAGG + Intronic
955246278 3:57227858-57227880 GGCGGAGGGAGGGCGGTGGCAGG - Exonic
955262492 3:57407298-57407320 GCCGGGGGTAGGGAGGTGGCAGG + Intronic
956084854 3:65597917-65597939 GGCGGGGGTGGGGGGGGGGTGGG + Intronic
957041671 3:75340744-75340766 GGAGGGGGCTGTGGAGTGGCTGG + Intergenic
957356198 3:79090446-79090468 AGCGGGGGGAGGGGAGGGGAGGG - Intronic
958026673 3:88058453-88058475 GGCGGGGGCGGGGGAGAGGCGGG + Intronic
958766329 3:98372482-98372504 GGCGAGGGGAGGGGAGGGGAGGG + Intergenic
958799410 3:98738084-98738106 GGCGGGGGTGGGGGGAGGGCGGG - Intronic
958833572 3:99117914-99117936 GTGGGGGGTAGGGGGGTGGGGGG - Intergenic
959596820 3:108137416-108137438 GGCGGGGGGAGGGGGGCGGACGG + Intergenic
959896647 3:111614227-111614249 GGTGGGGGTAGGGAAGAGACAGG + Intronic
960096702 3:113696530-113696552 GGCGGGGGGAGAGGAGGGCCTGG - Exonic
960266337 3:115624894-115624916 GGTGGGGGTGGGGGTGTGGTGGG + Intronic
960740808 3:120831277-120831299 TGCGGGGGTAGGGGAAAAGCAGG + Intergenic
961236873 3:125375041-125375063 GGCGGGGGAGGGGGAGGGGGCGG - Intronic
961403044 3:126660573-126660595 GGCTGGGGTAGAGGGGTGGGTGG - Intergenic
961663836 3:128484328-128484350 GCCGAGGGTAGGGTGGTGGCAGG + Intronic
961673134 3:128549304-128549326 GGTGGGGGTGGGGCCGTGGCTGG + Intergenic
961674361 3:128555676-128555698 GGGTGGGGGTGGGGAGTGGCCGG + Intergenic
961695915 3:128704357-128704379 GGTGGAGGCAGGAGAGTGGCAGG + Intergenic
961714685 3:128850175-128850197 GGCGGGGTTAGGGGAGAAGGAGG + Intergenic
961780450 3:129317409-129317431 GGCTGGGGCTGGGGGGTGGCAGG + Intergenic
961819492 3:129567951-129567973 GGTGGGGGGTGGGGAGTTGCGGG + Intronic
961940950 3:130636920-130636942 GGAGGGGGAAGGGGAGGGGAGGG - Intronic
962072210 3:132044686-132044708 GGAGGGGGGAGGGGAGGGGGAGG + Intronic
962072309 3:132044884-132044906 GGAGGGGGGAGGGGAGGGGAGGG + Intronic
962072345 3:132044950-132044972 GGAGGGGGGAGGGGAGGGGAGGG + Intronic
962331921 3:134485983-134486005 GGAGGGGGGGGGGGCGTGGCAGG - Exonic
962891734 3:139678057-139678079 GGCGGGGGCAGGGGAGAGGGCGG - Intergenic
962914620 3:139888807-139888829 GGAGGGGGGAGGGGAGGGGAGGG - Intergenic
963039591 3:141059018-141059040 GGAGGGAGTAGTGCAGTGGCTGG + Intronic
963429796 3:145185034-145185056 GGAGGTTGTAGGGGAGTGGTGGG + Intergenic
963545917 3:146658447-146658469 GGCAGGGATAGCGGGGTGGCAGG - Intergenic
963603288 3:147394959-147394981 GGCGGGAGAAGGGGACTGGTGGG - Intronic
963839796 3:150093699-150093721 GGCGGGGGTGGGGGATAGTCGGG - Intergenic
963868192 3:150385467-150385489 GGTGGGGGTAGGGGATGGGGTGG + Intergenic
963988883 3:151630143-151630165 GGTGGGGGTTGGGGAGTAACTGG - Intergenic
964002841 3:151796201-151796223 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
964607565 3:158573371-158573393 GGCGGGGGGAGGGGGGCGGGAGG + Intronic
964871614 3:161319270-161319292 GGCGGGGGAAGTGGGGTGGGGGG + Intergenic
965045889 3:163576536-163576558 GGAGGGGGGAGGGGGGAGGCAGG - Intergenic
966364768 3:179173476-179173498 GGCTGAGGCAGGGGAATGGCAGG + Intronic
966464196 3:180211822-180211844 GGCAGGGGTAGGGGGGAGGTGGG - Intergenic
966678364 3:182613733-182613755 GGCTGGGGTAGGTGGGAGGCAGG - Intergenic
966809924 3:183834567-183834589 GCCAGGGGTAGAGGAGGGGCAGG + Intronic
966818119 3:183905609-183905631 GTCGGGGGTGGGCGAGTGGGGGG + Intergenic
966869095 3:184278406-184278428 AGCGGGGGTAGGGGTGGGGCCGG - Intronic
966883603 3:184362730-184362752 GCCCGGGGGAGGGGGGTGGCGGG + Intronic
966936954 3:184717028-184717050 AGCGGGGGAGGGGGAATGGCAGG + Intergenic
967151041 3:186651360-186651382 GGAGGGGGTAAGGTAGTGGCAGG - Intronic
967456305 3:189690371-189690393 GGGGGGAGTAGGAGAGTGTCTGG - Intronic
968133691 3:196207629-196207651 GGCGGGGCCAGGGGCGGGGCGGG - Intronic
968133738 3:196207726-196207748 GGCGGGGCCAGGGGCGGGGCGGG - Intronic
968150557 3:196334802-196334824 GGTGGGGGTAGGAGAGAGGAAGG + Intronic
968150761 3:196335362-196335384 GGTGGGGGTAGGAGAGGGGAGGG + Intronic
968150806 3:196335467-196335489 GGTGGGGGTAGGAGAGGGGAGGG + Intronic
968150821 3:196335502-196335524 GGTGGGGGTAGGAGAGAGGTGGG + Intronic
968319200 3:197750317-197750339 GGCGGGGGCAGGGGCGCTGCGGG + Intronic
968328444 3:197842620-197842642 GGTAGCGGTAGGGGAGTGGTAGG - Intronic
968473161 4:791176-791198 GGCGGGGGGCGGGGAGCGGGGGG + Intronic
968514738 4:1011399-1011421 GGCGGGGGCGGGGGCGGGGCCGG + Intronic
968517337 4:1020775-1020797 GGCAGGGGAAGGGGTGGGGCTGG + Intronic
968592294 4:1465230-1465252 GGCAGGGGCAGGGGTGAGGCAGG - Intergenic
968701832 4:2061175-2061197 GGCGGAGGTCGGGGAGCGGCGGG - Intronic
968746958 4:2365158-2365180 GGAGGGGGCAGGGGAGGCGCGGG + Intronic
968803270 4:2756502-2756524 GGCGGTGGGAGGGGTGGGGCCGG - Intergenic
969098621 4:4752585-4752607 GGCCGTGGCAGGGGAGTGGGAGG - Intergenic
969112354 4:4851963-4851985 GGGGAGGGGAGGGGAGGGGCGGG - Intergenic
969221451 4:5761493-5761515 GGCGGGGGGCGGGGGGTGGTTGG + Intronic
969285701 4:6200664-6200686 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
969377768 4:6774299-6774321 GGCGGAGGGAGGGGAATGGGGGG + Intergenic
969396805 4:6927062-6927084 GGTGGGAGCAGGGGAGTGACAGG + Intronic
969455439 4:7297405-7297427 GGTGGGGGTGGGGGAGGGGCGGG - Intronic
969482998 4:7456769-7456791 GGCAGGGGTAGGGGGGTGGAGGG + Intronic
969518539 4:7662225-7662247 GGTGGGGGTGGGGGAGGGGGGGG - Intronic
969537987 4:7768408-7768430 GGCGGTGCTAGGGAAGGGGCTGG + Intronic
969551002 4:7867115-7867137 GGGGAGGGTAGGGGAGCGGAGGG + Intronic
969619000 4:8269662-8269684 GGCGGGGCTGGCGGAGGGGCCGG + Intergenic
969693948 4:8724532-8724554 GGCAGGGGCAGGTGGGTGGCAGG + Intergenic
969714290 4:8860970-8860992 GGCGGGGGAGGGGGCGGGGCCGG + Intronic
969868900 4:10092842-10092864 GGCTGGGGTGGGGCAGAGGCAGG - Intronic
971727751 4:30335625-30335647 GGAGGGGGGAGGGGAGGGGAAGG + Intergenic
972390772 4:38610893-38610915 GACGGGGGTTGGGGGGTGGGGGG - Intergenic
972396911 4:38664970-38664992 GGCGGAGGGAGGGGAGGGGAAGG - Intronic
972686891 4:41360714-41360736 GGCCGGGGGCGGGGAGAGGCGGG + Intronic
972709326 4:41578714-41578736 GGGGAGGGGAGGGGAGTGGAAGG - Intronic
973255456 4:48107709-48107731 GGCGGGGGTTGGGGCGAGGGCGG - Intronic
973779144 4:54271977-54271999 GGAGGGGGGAGGGGAGGGGGAGG - Intronic
973821330 4:54664263-54664285 GCTGGGGGTAGGGAATTGGCTGG + Intronic
974003120 4:56530547-56530569 GGCGGGGCTCGGGGCGGGGCTGG + Intergenic
974626543 4:64433316-64433338 GGCTGGGGAGGGGGAGGGGCAGG + Intergenic
975047194 4:69820476-69820498 GTCGGGGGTTGGGGAGTGGTGGG - Intronic
975702026 4:77075790-77075812 GGCGGGGGCCGGGGAGAGGCGGG + Exonic
975816120 4:78218022-78218044 GGAGGGGGGAGGGGAGGGGAAGG - Intronic
976475194 4:85475304-85475326 GGCGGGGGTGGCTGGGTGGCTGG + Exonic
976642810 4:87356907-87356929 GGTTGGGGTAGGGTAGTGGCAGG - Intronic
977536552 4:98261361-98261383 GGCGGGGGGCGGGGCGGGGCGGG - Intergenic
977761221 4:100739289-100739311 GGTGGGGGTGGGGGTGGGGCGGG - Intronic
977785892 4:101034485-101034507 GGAGGGGGTGGGGGCATGGCAGG - Intronic
977795907 4:101164222-101164244 GGGTGGGATAAGGGAGTGGCAGG - Intronic
977805140 4:101288546-101288568 GGGAGGGGGAGGGGAGTGGTCGG + Intronic
978291787 4:107150549-107150571 GGGGAGGGGAGGGGAGGGGCAGG + Intronic
978382411 4:108143647-108143669 GGCGGGGGCAGGGGATTGAGGGG - Intronic
978422390 4:108546740-108546762 GGCGGGGGAGGGGGGGTTGCTGG - Intergenic
978457108 4:108906415-108906437 GGTGTGGTTAGGGGAGTGGGGGG - Intronic
978577180 4:110199042-110199064 GGTGGGGGTAGGGGTGGGGGTGG - Intronic
978665644 4:111178086-111178108 GGAGAGGGGAGGGGAGGGGCGGG - Intergenic
979280870 4:118866283-118866305 TGTGGGGGTCGGGGAGTGGGAGG - Intronic
979730558 4:124018378-124018400 GGAGAGGGGAGGGGAGTGGAGGG - Intergenic
980091482 4:128447571-128447593 GGCTGGGGTTGGGGAGCTGCAGG + Intergenic
980243515 4:130206922-130206944 GGTGGGGGGAGGGGAGAGGAGGG - Intergenic
980343749 4:131584574-131584596 GGAGTGGGTGGGTGAGTGGCAGG + Intergenic
980751489 4:137095768-137095790 GGTGGTGGTAGGGGAGTGGAAGG + Intergenic
980900077 4:138896579-138896601 GGCTGAGGCAGGAGAGTGGCGGG - Intergenic
980908839 4:138975714-138975736 GGCGGGGGTGAGGTAGGGGCGGG - Intergenic
980990492 4:139735062-139735084 GGCGGGGGCCGCGGAGGGGCGGG - Intronic
981305454 4:143242304-143242326 GGAGTTGGTAGGTGAGTGGCAGG - Intergenic
982042393 4:151409105-151409127 GGCGGGGGCCGGGGCGGGGCAGG - Intergenic
982075129 4:151731090-151731112 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
982233161 4:153227759-153227781 GGTGGGGGAAGGGGAAGGGCTGG + Intronic
982329813 4:154169459-154169481 GGCGAGGGGAGGGGAGGGGAGGG - Intergenic
983646380 4:169996002-169996024 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
983828209 4:172291718-172291740 GGCAGGGGGAGGGGGGTGGCGGG - Intronic
984911311 4:184676624-184676646 GGAGGGGGAAGGGGAGGGGAAGG - Intronic
985277559 4:188252627-188252649 GGCGGGTGGAGGGGAAAGGCTGG + Intergenic
985478416 5:92346-92368 CGCGGGGGTAGGGGCGGGGTGGG + Intergenic
985478445 5:92399-92421 CGCGGGGGTAGGGGTGGGGTGGG + Intergenic
985524883 5:396791-396813 GGTGGGGGTCGGGGAGAGGGCGG - Intronic
985549420 5:525451-525473 GGTGGGGGTCAGGCAGTGGCTGG - Intergenic
985565246 5:612224-612246 GGCGGGGCGAGGGGCGTGGCTGG - Intergenic
985595178 5:784754-784776 GGCGGGGCTGGGGGCGGGGCGGG - Intergenic
985613138 5:901721-901743 GGCTGAGGTAGGAGAGTTGCTGG - Intronic
985636071 5:1036489-1036511 GGGGGGGGTTGGGGGGGGGCGGG - Intronic
985837019 5:2278947-2278969 GGCGGGCGGCGGGGAGTGACAGG + Intergenic
985896452 5:2752089-2752111 GGTGGGGGCGGGGTAGTGGCTGG - Intergenic
986338861 5:6773840-6773862 GGCGGGGGGTGAGGAGCGGCGGG - Intergenic
986415032 5:7519810-7519832 GCTGGGGGAAGGGGACTGGCTGG - Intronic
986608619 5:9546167-9546189 GGCGGGGGCGGGGCAGGGGCGGG - Intergenic
986755587 5:10832882-10832904 GGCGGGGGAAGGGCAGGGGTGGG + Intergenic
987201942 5:15586254-15586276 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
988042940 5:25911598-25911620 GGCAGTGGTAGGGGAGGGGAGGG - Intergenic
988517020 5:31913931-31913953 GCTGGGGGTAGGGGAGAGGTTGG - Intronic
988801180 5:34698119-34698141 GGAGGGGGGAGGGGAGGGGGAGG - Intronic
988927483 5:36004252-36004274 GGCAGGGGTGGGGGATTGGGGGG - Intergenic
989983259 5:50667353-50667375 GGGAGGGGAAGGGGAGAGGCTGG - Intronic
990210606 5:53479220-53479242 GGCGGGGGGAGGGCAGTTGCAGG + Intergenic
990443153 5:55866531-55866553 GGCAGGGGTAGGGGTGGGGGCGG + Intronic
990743694 5:58937224-58937246 GGCGGGAGCAGGGGAGGGGGAGG + Intergenic
990743713 5:58937259-58937281 AGCAGGGGAAGGGGAGGGGCGGG + Intergenic
990781758 5:59372630-59372652 GCTGGGGGTAGGGTGGTGGCAGG - Intronic
991245771 5:64506875-64506897 GCTGAGGGTGGGGGAGTGGCTGG - Intronic
991261993 5:64677469-64677491 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
992251197 5:74877407-74877429 GGTGGGGGAATGGGAGGGGCAGG - Intergenic
992474493 5:77088490-77088512 GGCGGGGGTAGAGGAGTTGGGGG + Intergenic
992485719 5:77192320-77192342 GGTGGGGGTTGGGAATTGGCTGG - Intergenic
992527721 5:77628640-77628662 CGTGGGGGGAGGGGAGGGGCCGG - Intergenic
992726443 5:79612353-79612375 GGGGGGGGTTGGGGGGTGGGGGG + Intronic
992726453 5:79612370-79612392 GGGGGGGGTTGGGGGGTGGGAGG + Intronic
993644433 5:90445354-90445376 GGGGAGGGGAGGGGAGTGGAGGG - Intergenic
994252004 5:97547005-97547027 GGCAGGAATAGGGCAGTGGCAGG + Intergenic
994457187 5:100025694-100025716 GGCGGGGGTGGGGGGGGGGGCGG + Intergenic
994536868 5:101042289-101042311 GGCTGAGGTAGGAGAATGGCGGG + Intergenic
994742815 5:103642453-103642475 GGCTGAGGCAGGGGAATGGCGGG + Intergenic
995735608 5:115296724-115296746 TGCGGGGGTGCGGGAGGGGCGGG + Exonic
995735675 5:115296880-115296902 GGCGGGTGTGGGGGCGGGGCGGG + Intergenic
995854353 5:116576356-116576378 GGAGGGGGTTGGGGAGTGTGGGG + Intergenic
995971270 5:117974023-117974045 GACAAGGGTAGGGGAGTGGTGGG - Intergenic
996502807 5:124235728-124235750 GGCGGGGGAAGGGTGGTGGGGGG - Intergenic
997211711 5:132080803-132080825 GGCTGGGGCAGGGAAGTGGAGGG - Intergenic
997302992 5:132820034-132820056 GTCGGGGGGAGGGGTGTGGGGGG - Intergenic
997670984 5:135671851-135671873 GGTGGGGGTGGGGGAGTAGAGGG - Intergenic
997852928 5:137348471-137348493 GGTGGGGGTGGGGGTGCGGCAGG + Intronic
997872220 5:137516297-137516319 AGCTGGGGTAGGGGAGAGGGTGG + Intronic
997965339 5:138352457-138352479 GGCCGGGGTAGGGAAGTGGGCGG - Intergenic
997999249 5:138610968-138610990 GGAGGGGGTTGGGCAGTCGCTGG + Intronic
998568919 5:143239838-143239860 GGCGGGGGTGGGGGTGGGGGTGG - Intergenic
998573054 5:143282468-143282490 GGCGGGGGTGGGGGCGCTGCTGG + Intronic
998903414 5:146878637-146878659 GGCGGGGGTAGGGAAGCTGGCGG + Intronic
999154452 5:149448396-149448418 TGCAGGGGTAAGGGAGTGGGAGG - Intergenic
999240536 5:150124901-150124923 GCCGGGGGTAGGGGAGTGGGGGG - Intronic
999517326 5:152314505-152314527 GGAGGGGGAAGGGGAGGGGAAGG - Intergenic
999655706 5:153808381-153808403 GACGGGGGGCGGGGAGTGGGGGG + Intronic
999731461 5:154478955-154478977 GGCAGGGGTAGGGGTGGGGCGGG + Intergenic
1000021329 5:157321742-157321764 GGCTGGGGCAGGGGAGAGGTGGG + Intronic
1000185255 5:158851920-158851942 GGGAAGGGTAGGGGAGGGGCAGG + Intronic
1000185264 5:158851937-158851959 GGCAGGGGAAGGGGAGGGGAAGG + Intronic
1000233264 5:159335032-159335054 GGTGGTGGGCGGGGAGTGGCGGG - Intergenic
1001264882 5:170266949-170266971 GGCGGGGCTAGGGGAGTGCCTGG + Intronic
1001364315 5:171121819-171121841 GGCAGGGGTGGGGGTGTGGTGGG - Intronic
1001396310 5:171421325-171421347 GGTGGGGGTCGGGGGGCGGCGGG + Intronic
1001489491 5:172145442-172145464 GGCGGGGGTGGGGCAGTGTGGGG + Intronic
1001490195 5:172149576-172149598 GGCAGGGGTTGGTGAGTGCCAGG + Intronic
1001667895 5:173448654-173448676 GGTTGGGGCAGGGGAGGGGCTGG + Intergenic
1001725177 5:173890490-173890512 GGTGGGGGATGGGGACTGGCAGG - Exonic
1002006419 5:176238361-176238383 GGCGGGGCTCGGGGCGGGGCCGG + Exonic
1002064416 5:176644956-176644978 GTCGGGGGGAGCTGAGTGGCTGG + Intronic
1002195063 5:177497009-177497031 GGGGGGGGGAGGGGAGGGGAGGG + Intronic
1002219961 5:177672276-177672298 GGCGGGGCTCGGGGCGGGGCCGG - Intergenic
1002275960 5:178104617-178104639 GGGTGGGGTGGGGGTGTGGCAGG + Intergenic
1002300144 5:178253240-178253262 GGCAGGGGTGGGGCAGGGGCTGG - Intronic
1002715560 5:181224498-181224520 GGCGGGGGCAGTGGGGTGACGGG - Exonic
1002764177 6:225466-225488 TGCGGGGGCAGTGGAGTTGCTGG + Intergenic
1002791564 6:441290-441312 GGCAAGGACAGGGGAGTGGCTGG - Intergenic
1002807052 6:587343-587365 GGCTGGGGCAGGAGAATGGCAGG - Intronic
1002866849 6:1129480-1129502 GGCGGGGGTGGGGGTTTGGGGGG + Intergenic
1002888804 6:1317052-1317074 GGCGGGGGGAGGGGGTAGGCTGG - Intergenic
1002888814 6:1317070-1317092 GGCGGGAGGAGGGGGGTGGGCGG - Intergenic
1003049195 6:2765191-2765213 TGCGGGGGCGGGGGAGGGGCGGG - Intergenic
1003098709 6:3160754-3160776 GGCGGGGGGCGGGGAAGGGCAGG + Intergenic
1003692280 6:8366498-8366520 GGCTGGGGTAGGGATGGGGCAGG + Intergenic
1004199606 6:13535643-13535665 GGCGGGGGCAGGGGGTGGGCTGG - Intergenic
1004528226 6:16429044-16429066 GGCGAGGGTAGGGGGGTGGGAGG + Intronic
1004627897 6:17393844-17393866 GGGTGGGGTAGGGAAGCGGCCGG + Intronic
1004658387 6:17686898-17686920 GGAGGGGGGCGGGGAGTGGGGGG + Intronic
1005511762 6:26517990-26518012 GTGGGGGGTAGGGGAGTGGGGGG + Intergenic
1005512121 6:26520853-26520875 GGCGGGGGCGTGGGAGGGGCGGG - Intergenic
1005709422 6:28489552-28489574 TGCGGAGGTGGGGGAGGGGCGGG + Intergenic
1006000708 6:30962959-30962981 GGAGGGGGGAGGGGAGGGGAGGG + Intergenic
1006021668 6:31121165-31121187 GGCGGGGGTGGGGGGGTGCTGGG + Intronic
1006187614 6:32189944-32189966 GGCGGGGGGAGGGGCGGAGCAGG - Exonic
1006315824 6:33290852-33290874 GGTGGGGGGAGGGGAGGGGAGGG + Exonic
1006430640 6:33993585-33993607 GGCGGGGGTGGGGGACGGGGTGG - Intergenic
1006519600 6:34563606-34563628 GACGGGGGTTGGGGGGTGCCAGG - Intergenic
1006844776 6:37054681-37054703 AGAGGGTGCAGGGGAGTGGCAGG - Intergenic
1007134466 6:39507929-39507951 GGTGGGGGGAGGGGAGTAGGAGG - Intronic
1007245804 6:40461566-40461588 GTCGGGGGGAGGGGGGTGGCTGG - Intronic
1007373834 6:41443319-41443341 GGCGGGGGTAGGGGGCAGGCGGG - Intergenic
1007473870 6:42106716-42106738 GGAGGGGGCAGGGGAGGGGCTGG + Exonic
1007496077 6:42261025-42261047 CGCGGGGATAGGGGAGGGGTGGG - Intronic
1007511335 6:42376398-42376420 GGCTGGGGTAGGGGAGAGACAGG + Intronic
1007738060 6:43994198-43994220 GGCAGGGGCAGGGGAATGCCAGG + Intergenic
1007759887 6:44127597-44127619 GGAGGGGGAGGGGGAGTCGCTGG - Intronic
1007759891 6:44127609-44127631 GGCGGGGCTGGGGGAGGGGGAGG - Intronic
1007772513 6:44202799-44202821 GGTGGGGGAGGGGCAGTGGCTGG - Intergenic
1007774420 6:44216988-44217010 GGTGGGGGTAGGGGACTGAGAGG + Intergenic
1007914341 6:45547002-45547024 AGCCGGGGTAGGGTGGTGGCAGG - Exonic
1007921328 6:45612160-45612182 GGGGGAGGTGGGGGAGAGGCAGG + Intronic
1008342725 6:50387410-50387432 GGTGGGGGCTGGGGAGTGGATGG - Intergenic
1008661557 6:53673174-53673196 GGCAGGGGTGGGGGAGAGCCAGG - Intergenic
1008665198 6:53709371-53709393 GGCGGGGGGAGGGGAGTTGGGGG - Intergenic
1008816911 6:55579214-55579236 GGCGGGGAGTGGGGCGTGGCAGG + Intronic
1009248402 6:61269005-61269027 AGGGGGGGTGGGGGAGTGGGAGG - Intergenic
1009441769 6:63688302-63688324 GGAGGGGGAAGGGGAGGGGGAGG - Intronic
1011410184 6:87059641-87059663 GGTGGGGGGAGGGGGGAGGCTGG + Intergenic
1011507817 6:88067652-88067674 GGCGGGGGTGGGGGTGTAGGGGG + Intergenic
1011664729 6:89622999-89623021 GGTTGGGGTGGGGGAGTGGGGGG + Intronic
1011722680 6:90175577-90175599 GGCGGTGGGGGGTGAGTGGCTGG + Intronic
1011814400 6:91171677-91171699 GGCGAGGGAAGGGGAGAGGAGGG + Intergenic
1012439956 6:99253560-99253582 GGAGGGGGTAAGTGAGAGGCTGG - Intergenic
1012448661 6:99332044-99332066 GGAGGGGGCTGGGGAGAGGCTGG - Intronic
1012450682 6:99349930-99349952 GGCCGGGGTAGGGGAGGACCGGG - Intronic
1012930244 6:105309083-105309105 GGCGGGTGAGGGAGAGTGGCAGG + Intronic
1013298459 6:108781087-108781109 GGAGGGGGTAGAGGAGGGGGTGG - Intergenic
1013298664 6:108782341-108782363 GGAGGGGGAAGGTGAGTGGAGGG + Intergenic
1013330425 6:109094954-109094976 GGCGGAGAAAGGGGAGGGGCTGG - Intergenic
1014043476 6:116855902-116855924 GGCTGAGGCAGGAGAGTGGCAGG + Intergenic
1014948024 6:127519048-127519070 GGACGGGGGTGGGGAGTGGCGGG + Exonic
1015098491 6:129446537-129446559 GGCGAGGGGAGGGGAGGGGAGGG + Intronic
1015790995 6:136964560-136964582 CCCAGGGGCAGGGGAGTGGCAGG - Intergenic
1016047948 6:139499688-139499710 GGTGGGGGATGGGGAGTGGGAGG - Intergenic
1016313779 6:142763247-142763269 GGAGAGGGAAGGAGAGTGGCGGG + Intronic
1017018819 6:150123749-150123771 GGGGAGGGGAGGGGAGGGGCAGG - Intergenic
1017105843 6:150886893-150886915 GGCTGAGGTAGGAGAATGGCTGG + Intronic
1017164197 6:151391719-151391741 GGCGGGGGGAGGGGAGCGGCTGG - Intergenic
1017446607 6:154511767-154511789 GGCGGGGGTGGGGGGTTGGGGGG - Intergenic
1017736654 6:157370871-157370893 GGGGGGGGGAGGGGAGAGGGAGG + Intergenic
1017737560 6:157379155-157379177 GGTGGGAGGAGGGGAGTGGATGG + Intergenic
1018027244 6:159816137-159816159 GGGGTGGGGAGGGGTGTGGCGGG - Intronic
1018400531 6:163415354-163415376 GGCGGGGGTCGGGCCGGGGCCGG - Intronic
1018623231 6:165751553-165751575 GGTGGAGGTAGGAGACTGGCAGG + Intronic
1018696707 6:166396585-166396607 GGCGGGGGTGGGGGCGGGGGTGG + Intergenic
1018727476 6:166625317-166625339 GGGGGGGGTGGGGGGGTGGTGGG - Intronic
1018798882 6:167207611-167207633 GGGGAGGGTAGGAGAGGGGCAGG + Intergenic
1018908139 6:168086998-168087020 AGCGGGGAGAGGTGAGTGGCTGG - Intergenic
1019289025 7:240956-240978 GGCTGAGGTAGAGGAGGGGCAGG + Intronic
1019341365 7:510491-510513 GGGGAGGGGAGGGGAGGGGCAGG + Intronic
1019366740 7:636944-636966 GGTGGGGGGTGGGGAGTGCCGGG + Intronic
1019381786 7:727688-727710 GGCGGGGCTTGGGGCGTGGAGGG - Intronic
1019472806 7:1230211-1230233 GGCGGGGGCGGGGGAGGGGCGGG + Intergenic
1019538370 7:1540380-1540402 GGCCGGGGGCGGGGGGTGGCGGG + Exonic
1019932101 7:4230446-4230468 GGAGAGGGAAGGGGAGTGGAGGG + Intronic
1020080439 7:5283394-5283416 GGCGGGGGCAGGGGAGCGATGGG - Intronic
1020153515 7:5702275-5702297 GGCGGGCCAAGGGGAGAGGCAGG + Intronic
1020191516 7:6002536-6002558 GGCGGGGGTAGGGGGTTTTCTGG + Exonic
1020256204 7:6504185-6504207 GGCGGGGCTTTGGGATTGGCCGG + Intronic
1021200392 7:17722691-17722713 GGAGGGGCTAGGGGAGTGGGAGG + Intergenic
1021510544 7:21428180-21428202 GGTGGGGGTGGGGGCGAGGCGGG - Exonic
1021576494 7:22110050-22110072 GGCTGGGGAAGGACAGTGGCTGG + Intergenic
1021639197 7:22721780-22721802 GACGGGGGTCGGGGAGAGGTGGG - Intergenic
1021969378 7:25951413-25951435 GGCGGGGGCGGGGGCGCGGCCGG + Intergenic
1021981812 7:26062584-26062606 GGCGGGGGTCAGGGAGTGCACGG + Intergenic
1022091397 7:27110227-27110249 GGCAGGGGTAGGGTTGTTGCTGG + Exonic
1022187017 7:27979726-27979748 GCAGGGGATAGGGGAGAGGCAGG - Intronic
1022207965 7:28180811-28180833 GGCGGGGGGAGGGCGGGGGCGGG + Intergenic
1022230491 7:28408949-28408971 GATGGGGGTAGGGGAGAGGTGGG - Intronic
1022473502 7:30695539-30695561 GGAGGGGGAAGGGGAGGGGAGGG + Intronic
1022503653 7:30897487-30897509 GGGGAGGGGAGGGGAGGGGCAGG - Intergenic
1022820629 7:33956621-33956643 GGTGGAGGAAGGGGAGTGGTTGG - Intronic
1022988821 7:35686814-35686836 GGGGGGGGTGGGGGGGTGGGGGG + Intronic
1023640438 7:42251469-42251491 GGGGGAGTTGGGGGAGTGGCTGG + Intergenic
1023688628 7:42763405-42763427 GGCAGGGGCAGGGAAGTGGCAGG - Intergenic
1023791701 7:43758390-43758412 GGAGGGCGTATGGAAGTGGCTGG - Intergenic
1023872325 7:44269684-44269706 GGCGGGGGCGGCGGAGGGGCAGG + Intronic
1024045445 7:45582567-45582589 GGCGGGGGGTGGGGGGTGGTGGG + Intronic
1024262239 7:47581641-47581663 GGCTGGGTTTGGGGACTGGCTGG - Intronic
1024501773 7:50117542-50117564 GGCAGGGGTAGTAGAGTAGCAGG - Intronic
1024606326 7:51025245-51025267 GGGGGTGGTGGGGGAATGGCTGG + Exonic
1025198475 7:56948785-56948807 GGCGGGGGCAGGGGAGCGATGGG + Intergenic
1025673476 7:63628148-63628170 GGCGGGGGCAGGGGAGCGATGGG - Intergenic
1026320079 7:69260517-69260539 GGCGGGGCTGGGGGAGCGGGTGG + Intergenic
1026359515 7:69590855-69590877 GGAGGCGGTAAGGGAGTGGAAGG + Intergenic
1026360431 7:69598048-69598070 GGCGGGGGCGGGGGCGTGGAGGG - Intergenic
1026497286 7:70914228-70914250 GGAGGGGGAAGGGGAGGGGGAGG - Intergenic
1026548561 7:71346752-71346774 GGCGGGGGTGGGTGGGTGGGTGG + Intronic
1026800656 7:73397881-73397903 GGCGGGGGGAGGGGAGGGGGAGG + Intergenic
1026847831 7:73707490-73707512 GGCGAGGGGAGGGGCGGGGCTGG + Intronic
1027187578 7:75981306-75981328 GGCAGGGGCAGGGCAGAGGCAGG - Intronic
1027374474 7:77536983-77537005 GGCGGGCTTGGGGGCGTGGCCGG + Intergenic
1027404584 7:77846547-77846569 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1027726276 7:81810043-81810065 GGCGGGGGTGGGGGTGTGGGTGG - Intergenic
1027810350 7:82888946-82888968 GGCGGGGGTGGGGCAGGGGGCGG - Intronic
1028086859 7:86645990-86646012 GGTGGGGGTGGGGGGGTGGGGGG + Intronic
1028113972 7:86976543-86976565 GGAGGGGGCAGGTGAGGGGCAGG - Intronic
1028306900 7:89277487-89277509 GGTGGGGGTAGGGGGGAGGGGGG - Intronic
1028376945 7:90154764-90154786 GCCGGGGGTTGGGGAGAGCCAGG + Intronic
1028382347 7:90212814-90212836 GGTGGGGGTGGGGGTGGGGCAGG - Intronic
1028744371 7:94310517-94310539 GCAGGGGGTCGGGGGGTGGCGGG - Intergenic
1028977970 7:96935065-96935087 GGCGGGGGTGGGGTGGTGGGGGG - Intergenic
1029113086 7:98223332-98223354 GGTGGGGGTGGGGGCCTGGCTGG - Intronic
1029211282 7:98910215-98910237 GGCGGGGGTGGAGGTGGGGCAGG - Exonic
1029494485 7:100889738-100889760 GGGGAGGGGAGGGGAGGGGCGGG - Intergenic
1029537942 7:101166768-101166790 GGCGGGGGTGGGGGGGAGGACGG + Intergenic
1029708331 7:102286812-102286834 GGCGGGGGCGGGGGCGGGGCGGG + Intronic
1029896502 7:103989733-103989755 CGCGGGGGCGGGGGAGCGGCCGG - Intergenic
1029976776 7:104842287-104842309 TGCGGGGGTGGGGGGGTGGGGGG + Intronic
1029990469 7:104958396-104958418 GGTGTGGGTTGGGGAGTGGGTGG - Intergenic
1030123433 7:106133046-106133068 GGGGGGGTTGGGGGGGTGGCGGG + Intergenic
1030185736 7:106759935-106759957 GGCGGGAGAAGGGGAGATGCTGG + Intergenic
1030330832 7:108268611-108268633 GGCGGGGGTGGGGGTGGGGGGGG + Intronic
1030861940 7:114642907-114642929 GGCTGGGGCAGGAGAATGGCAGG - Intronic
1031427293 7:121621192-121621214 GGTGGGGGTTGGGGGGTGGCGGG + Intergenic
1031494682 7:122431922-122431944 GGCGGGGGTGGGGGTGGGGAGGG + Intronic
1031898268 7:127379838-127379860 GGGGGGGGTGGGGGGGTGGGGGG - Intronic
1031978106 7:128106580-128106602 GGTGGGGGTGGGGGCGTGGTTGG - Intergenic
1032231616 7:130079758-130079780 GGAGGAGGTAGGGGAGGGGGAGG - Intronic
1032298835 7:130668481-130668503 CGCGAGGGGAGGGGAGGGGCCGG + Intronic
1032530316 7:132614870-132614892 GGCGGAGATGGAGGAGTGGCTGG + Intronic
1032614986 7:133458857-133458879 GGCGGGGGTGTGGGGGTGGGAGG - Intronic
1032824637 7:135557246-135557268 GGCGGGGGGTGGGGAGGGGAGGG + Intergenic
1032975850 7:137221565-137221587 GGCGAGGGGAGGGGAGGGGAGGG + Intergenic
1033052873 7:138022193-138022215 GGTGGGGGTGGGGGTGGGGCCGG + Intronic
1033242270 7:139690061-139690083 GGCGGGGGTGGGGGAGTGCGGGG + Intronic
1033242366 7:139690702-139690724 GGCGGGGGCAGGGGAGTGCCAGG - Intronic
1033322458 7:140352229-140352251 GGTGGGGGTGGGGGAGAGGTGGG + Intronic
1033354912 7:140591929-140591951 GGAGGGGGGAGGGGAGGGGAGGG - Intronic
1033705481 7:143882132-143882154 GGAGGGGGCTGGGGAGTGGGGGG + Intronic
1033763889 7:144466172-144466194 AGCAGGGGTCGGGGAGGGGCTGG - Intronic
1034273173 7:149812981-149813003 TGTGTGGGTGGGGGAGTGGCGGG + Intergenic
1034422711 7:150997806-150997828 GACAGGGGCAGGGGAGTGGCAGG - Intronic
1034491742 7:151396511-151396533 GGAGGAGGTAGGGGAGCAGCGGG + Intronic
1034629238 7:152517568-152517590 GGCTGAGGTAGGAGAATGGCAGG + Intergenic
1034662614 7:152785380-152785402 GGGGGGGGGAGGGGAGGGGGAGG + Intronic
1034811658 7:154137642-154137664 GGGGGGGGTGGGGGGGTGGGGGG + Intronic
1034814971 7:154164226-154164248 GGCGAGGGGAGGGGAGGGGAGGG - Intronic
1034960099 7:155359555-155359577 GGCTGGGGCTGGGGAGTGGCTGG + Intronic
1034963147 7:155374586-155374608 GGCGGGGGTGGGGGCGAGGAAGG + Intergenic
1034994790 7:155570892-155570914 GGCGGGGGTGGGGGCGGGGGCGG - Intergenic
1035050447 7:155995736-155995758 GGTGGGGGTGGGGGTGGGGCAGG + Intergenic
1035115635 7:156520960-156520982 AGAAGGGGAAGGGGAGTGGCAGG + Intergenic
1035224548 7:157426100-157426122 GCCAGGGGTTGGGGAGGGGCTGG + Intergenic
1035624012 8:1058189-1058211 GGCGGGTCTGGGGGTGTGGCCGG + Intergenic
1035671000 8:1417078-1417100 GGCGGGGGTGGGGGGATGGGGGG + Intergenic
1035717076 8:1763408-1763430 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717085 8:1763425-1763447 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717094 8:1763442-1763464 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717103 8:1763459-1763481 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717112 8:1763476-1763498 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717121 8:1763493-1763515 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717130 8:1763510-1763532 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717139 8:1763527-1763549 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717148 8:1763544-1763566 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717157 8:1763561-1763583 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717166 8:1763578-1763600 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1036172029 8:6496519-6496541 GGCGGGGGAAGGGGGGCGGGGGG - Intronic
1036259284 8:7227816-7227838 CGCGGGGGTCCGGGAGTGCCAGG - Intergenic
1036307342 8:7611705-7611727 CGCGGGGGTCCGGGAGTGCCGGG + Intergenic
1036358186 8:8059689-8059711 CGCGGGGGTCCGGGAGTGCCGGG + Intergenic
1036392542 8:8336881-8336903 GGTGTGGGGAGGGGAGTGGGGGG - Intronic
1036635541 8:10547709-10547731 GGTGGGGGAAGGGGAGAGGGAGG - Intronic
1036753393 8:11456946-11456968 GGCTGGGTTAGGGAAGTGGGCGG + Intronic
1036753410 8:11456992-11457014 GGCTGGGTTAGGGAAGTGGGCGG + Intronic
1036753468 8:11457130-11457152 GGCTGGGTTAGGGGTGTGGGTGG + Intronic
1036766645 8:11553707-11553729 GGCTGGGGTGGGGGTGTGGAGGG + Intronic
1036892764 8:12607254-12607276 CGCGGGGGTCCGGGAGTGCCGGG - Intergenic
1037067890 8:14605533-14605555 GGAGGGGCTTGGGGAGTGGGTGG - Intronic
1037110541 8:15159738-15159760 GGCGGGGGTGGGGGGGAGGGTGG - Intronic
1037288765 8:17328565-17328587 GGCGGGGGTGGGGGAGTGGAGGG + Intronic
1037591073 8:20312739-20312761 GGAGGGGGTAGGGCTGTAGCTGG - Intergenic
1037688476 8:21163595-21163617 GGCGGGGTTAGTGGAAGGGCCGG - Intergenic
1037691435 8:21184569-21184591 CGCGGGGGGTTGGGAGTGGCTGG - Intergenic
1038166265 8:25087982-25088004 GGAAGGGGCAGGGGAGGGGCGGG + Intergenic
1038429800 8:27491089-27491111 GGCGGGGCCAGGGCAGGGGCGGG + Exonic
1038568752 8:28641714-28641736 GGAGGGGGTCGGGGAGGGGGTGG - Intronic
1038646894 8:29369450-29369472 GGGGAGGGTAGGGGAGGGTCAGG + Intergenic
1038828722 8:31033731-31033753 GGCGGGGAAAGGGGTGGGGCAGG + Intergenic
1039382944 8:37102860-37102882 GGCTGGGGTTGGGGAGAGGGAGG - Intergenic
1039448321 8:37649888-37649910 GGCACGGGGATGGGAGTGGCTGG + Intergenic
1039948997 8:42153217-42153239 GGCGGGGAGAGGTGAGGGGCCGG + Intronic
1040688818 8:49910280-49910302 GACGGGGGTCCGGGAGGGGCGGG - Intronic
1040863275 8:52022811-52022833 GATGGGGGTAGGGGAGGGGGAGG - Intergenic
1040931934 8:52744560-52744582 GGCTGAGGTAGGAGAATGGCTGG - Intronic
1040939139 8:52815195-52815217 GGCGGGGGTTGGGGGGTGCGTGG - Intergenic
1041304583 8:56446515-56446537 GGCGGGCGTCGGGGAGAAGCGGG + Intronic
1042039892 8:64579899-64579921 GGCGAGGGAAGGGCAGTGGGGGG + Intergenic
1042307728 8:67348858-67348880 GGTGGGGGTGTGGGAGTGGGCGG + Intergenic
1042557320 8:70044401-70044423 GTAGGGGGTGGGGGAGGGGCAGG - Intergenic
1042580368 8:70270565-70270587 GGCGGGGGTGGGGGGATAGCAGG + Intronic
1043465835 8:80506560-80506582 GGCGGGGGTTGGGGGGGGGGTGG - Intronic
1043577547 8:81675242-81675264 GGCGGGGGTGGGGGGGTGGTGGG - Intronic
1043844930 8:85152877-85152899 TGGGGGGGTAGGGGAGGGTCAGG - Intergenic
1043872898 8:85454711-85454733 GTGGTGGGTTGGGGAGTGGCAGG + Intergenic
1043960677 8:86414883-86414905 GGCGGGGGTGGGGGGATGGGGGG - Intronic
1043972944 8:86552959-86552981 GGCGGGGGGGGGGGGGGGGCGGG - Intronic
1044340463 8:91040903-91040925 AGCGGGGGGAGGGGAGGGGAGGG + Exonic
1044340489 8:91040970-91040992 GGCTGGGGGAGGGGAGGGGAGGG + Exonic
1044844960 8:96371592-96371614 GGTGGGGGATGGGGAGGGGCAGG + Intergenic
1044932030 8:97260150-97260172 GGAGGGGGAAGGGGAGGGGAGGG + Intergenic
1044996895 8:97845862-97845884 GGGGAGGGGAGGGGAGTGGAAGG - Intronic
1045287575 8:100805253-100805275 GCAGGGGGTGGGGGAGTGGTGGG - Intergenic
1045305436 8:100952771-100952793 AGCCGGGGAAGGGGAGCGGCGGG - Intronic
1045492298 8:102679329-102679351 GGCGTGGGTATGAGTGTGGCAGG + Intergenic
1046094313 8:109539675-109539697 GGCGGGGCTAGAGGAGGGGCTGG + Intergenic
1046254801 8:111681942-111681964 TGGGGGGGTAGGGTAGTGGGGGG - Intergenic
1046890354 8:119415843-119415865 GTTGGGGGGAGGGGAGTGGCAGG - Intergenic
1046936051 8:119887114-119887136 GGGGGGGGGAGGGGAGGGGGAGG - Intronic
1047225867 8:122955067-122955089 GCCGGGGGGGGGGGGGTGGCAGG + Intronic
1047492843 8:125388661-125388683 GGTGGGGGGAGGGGAGCGGGCGG - Intergenic
1047962997 8:130024503-130024525 GGTGGGGGTTGGGGGGTGGGGGG - Intergenic
1048179199 8:132179978-132180000 GGCGGGGCTGGGGTAGGGGCAGG - Intronic
1048389513 8:133948164-133948186 GGTGGGGGTGGGGGGGTGGCTGG + Intergenic
1048486952 8:134857196-134857218 GGCGGGGGTAGGGGCGAGAGAGG + Intergenic
1048633606 8:136271540-136271562 GGCGGGGGGGGGGGGGCGGCAGG - Intergenic
1048814296 8:138317336-138317358 GCCAGGGGTTGGGGAGTGGATGG + Intronic
1048825223 8:138417514-138417536 GGCAGTGGTGGGGCAGTGGCTGG - Intronic
1048878150 8:138852694-138852716 TGCGGGGGATGAGGAGTGGCCGG + Intronic
1049103603 8:140597468-140597490 GGCGGGGGGGGGGGGGTGGGGGG - Intronic
1049108786 8:140629910-140629932 GGCGAGGGGAGGGGAGCGGAGGG + Intronic
1049231960 8:141489149-141489171 GGGTGGGGTTGGGGTGTGGCAGG - Intergenic
1049240657 8:141535955-141535977 GGCGGGCGGTGGGGAGGGGCGGG + Intergenic
1049258381 8:141625774-141625796 GGTGGTGGGATGGGAGTGGCAGG + Intergenic
1049365605 8:142235393-142235415 GCCGGGGGTAGGGGTGGGGGTGG - Intronic
1049548596 8:143246278-143246300 GGCGGGGGCTGGGGGTTGGCGGG + Intergenic
1049610527 8:143552921-143552943 GGCAGGGGTAGGGGAGTGGGGGG + Intergenic
1049610547 8:143552956-143552978 GGTGGGGGTAGGGGAGGGGAGGG + Intergenic
1049611909 8:143559718-143559740 GGTGGGGGCGGGGGAGAGGCGGG + Intronic
1049651368 8:143771393-143771415 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1049664597 8:143837338-143837360 GGCGAGGGGAGGGGAGGTGCGGG + Intronic
1049708085 8:144051862-144051884 GGCGGGGGTGGGGGCGGGGGCGG + Intronic
1049739622 8:144231531-144231553 GGCGAGAGGTGGGGAGTGGCTGG + Intronic
1049760274 8:144329047-144329069 ACCGGGGGTGGGGGCGTGGCGGG + Intergenic
1049771303 8:144383250-144383272 GGCAGGGGTTGCGGCGTGGCGGG + Intronic
1049788560 8:144462725-144462747 GGCGGCGGCAGGAGAGCGGCGGG - Intronic
1050151595 9:2622888-2622910 GTGCGGGGTAGGGGAGCGGCGGG + Intronic
1050161467 9:2724022-2724044 GCCGGGGGTTGGGGGGTGGAGGG + Intronic
1050309647 9:4339843-4339865 GGAGGGGGTAGGGGAGGGGTGGG + Intronic
1050566667 9:6891126-6891148 GGTGGGAGTAGGGGATGGGCAGG + Intronic
1050682329 9:8126770-8126792 GGTGAGGGTAGGGGTGAGGCTGG - Intergenic
1050723626 9:8620608-8620630 GGCGGGGGGCAGGGGGTGGCAGG + Intronic
1050941821 9:11470519-11470541 GGAGGGGTTAGGGGAGGGACAGG + Intergenic
1051170372 9:14314676-14314698 GGCGGGGGGTGTGGAGAGGCTGG - Intronic
1051173550 9:14343049-14343071 CGGGGGGGTAGGGGAGTGGGTGG + Intronic
1051287692 9:15513163-15513185 GGGGGGGGGAGGGGAGGGGAGGG + Intergenic
1051416590 9:16847399-16847421 GGCGGGGGGGGGGGGGCGGCGGG + Intronic
1052821515 9:33141169-33141191 GGGGTTGGTAGGGGAGTGGGCGG + Intronic
1053101878 9:35377975-35377997 GGAGGGGGAAGGGGAAGGGCAGG + Intronic
1053180269 9:35962398-35962420 GGCGGGGGCAGGGATGGGGCGGG - Intergenic
1053230094 9:36400886-36400908 GGGGCGGGGAGGGGCGTGGCCGG - Intronic
1053233642 9:36433127-36433149 GGGGAGGGTAGAGGAGGGGCTGG + Intronic
1053297943 9:36928268-36928290 GGCGGAGGTAGGACAGTGTCTGG - Intronic
1053354398 9:37433949-37433971 GGCTGGGGTGGGGGAGGGACGGG - Intronic
1053387225 9:37702620-37702642 GGCCTGGGAAGGGGAGTGGTGGG + Intronic
1053446159 9:38154742-38154764 GGGGAGGGTAGGGGGCTGGCCGG + Intergenic
1053463467 9:38288480-38288502 GACAGGGGTAGGGGAGGGGATGG - Intergenic
1055187495 9:73474267-73474289 GGAGGGGGAGGGGGAGGGGCAGG - Intergenic
1055689642 9:78815928-78815950 GGGGGGGGTGGGGGGGTGGGGGG - Intergenic
1056102433 9:83312736-83312758 GGCGGCGGAGGGGGAGTGGTGGG - Intronic
1056369587 9:85941068-85941090 GGCGAGGGAGGGGGTGTGGCCGG + Intergenic
1056638053 9:88347706-88347728 GGGGAGGGGAGGGGAGGGGCGGG - Intergenic
1056643418 9:88389004-88389026 GGCGGGGCGGGGGGAGGGGCGGG + Intronic
1056710901 9:88991344-88991366 GGCGGGGGACGGGGAGAGGGGGG + Intronic
1056713229 9:89008509-89008531 GGCGGGGCCAGGGGGGTGGAAGG + Intergenic
1056799537 9:89681480-89681502 GGCGGGGGCAGCGGTGCGGCGGG - Intergenic
1057222288 9:93263791-93263813 GGTGGGGGTGGGGCCGTGGCGGG + Intronic
1057392089 9:94648498-94648520 AGCTGGGGCAGGGGAGTGGTGGG - Intergenic
1057429873 9:94983839-94983861 GGAGGGGGGAGGGGAGGGGACGG - Intronic
1057547032 9:96026431-96026453 GGCGGGGGTGGGGGAAGCGCGGG + Intergenic
1057738815 9:97692851-97692873 GGGTGGGGTTGGGGGGTGGCTGG - Intronic
1058139516 9:101342538-101342560 GGAGGGGGAAGGGGAATGGGAGG + Intergenic
1058826674 9:108781527-108781549 GGCAGGGGTGGGGAAGAGGCTGG - Intergenic
1058912858 9:109536921-109536943 GGTGGGGGGAAGGGAGGGGCAGG - Intergenic
1059197033 9:112380051-112380073 GGGGGGGGCAGGGGCGGGGCAGG + Exonic
1059421637 9:114196095-114196117 GGCTGGGGCTGGGGAGAGGCAGG - Intronic
1059802457 9:117763982-117764004 GATGGGGGTAGGGGAGTGTCAGG - Intergenic
1059969264 9:119648205-119648227 GGCTGGGGCAGGAGAATGGCGGG + Intergenic
1060479758 9:124011393-124011415 GGCGGGGGTGGGGGGGAGGCAGG - Intronic
1060876055 9:127084418-127084440 GGTGGGGGTAGGGGCAGGGCAGG - Intronic
1061192153 9:129088164-129088186 GGGGAGGGTAGGGGGGTGGGAGG + Intronic
1061231891 9:129320212-129320234 GGCAGGTGTAGGGGCCTGGCCGG - Intergenic
1061306450 9:129735808-129735830 GGTGGGTGTCGGGGAGTGGTGGG - Intergenic
1061534348 9:131238499-131238521 GGCGGGGGCTGGGCAGAGGCCGG + Intergenic
1061559751 9:131394571-131394593 CTCGGGGGTACGGGGGTGGCGGG - Intronic
1061678841 9:132232686-132232708 GGCGGGGGACAGGGTGTGGCAGG - Intronic
1061853270 9:133428564-133428586 GGCGGGGGTGGGGGCGGGACGGG - Intronic
1061881685 9:133572169-133572191 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
1061920675 9:133780650-133780672 GGCGGGGGTGGGGCAGAGGGAGG + Intronic
1062025551 9:134338623-134338645 GGTGGGGGCAGGGGAGGGGCTGG + Intronic
1062103796 9:134741823-134741845 GGCGGGAGGTTGGGAGTGGCAGG - Intronic
1062105711 9:134753763-134753785 GGGGGTGGCAGGGGAGGGGCAGG - Intronic
1062126095 9:134863901-134863923 GGCGGGGGAAGGGGTGGGGATGG - Intergenic
1062264874 9:135682379-135682401 GGCTGGGCTACGGGAGAGGCAGG - Intergenic
1062324631 9:136006097-136006119 GGAGGGGGTGGGGGAGGGGGAGG + Intergenic
1062327433 9:136018967-136018989 GGCAGGGGCTGGGGAGGGGCGGG - Intronic
1062327813 9:136020540-136020562 GGCGGGGGTAGGAGGGAGACGGG + Intronic
1062362521 9:136194389-136194411 AGCGGGGGTTGGGGGGTGGGGGG + Intergenic
1062362966 9:136196202-136196224 TGCGGGGGTTGGGGAGTGTTGGG - Intergenic
1062376100 9:136262553-136262575 GGCAGGGCTAGGGCAGTGCCGGG + Intergenic
1062380382 9:136284119-136284141 GGAGAGGGGAGGGGAGGGGCAGG + Intronic
1062385441 9:136309177-136309199 GGCGGGGCTGGGTGGGTGGCAGG + Intergenic
1062399510 9:136366268-136366290 AGTGGGGGTAAGGCAGTGGCAGG - Intronic
1062519504 9:136951831-136951853 GGTGGGGGTAGGGGGGCGGCTGG + Intronic
1062528353 9:136987795-136987817 GACGGAGGGAGGGGAGTGGATGG - Intergenic
1062619176 9:137411734-137411756 GGAGGGGGTGGGGGAGTGGGAGG + Intronic
1062628642 9:137454046-137454068 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628659 9:137454084-137454106 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628676 9:137454122-137454144 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628693 9:137454160-137454182 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628710 9:137454198-137454220 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628726 9:137454236-137454258 GGCCGGGCTGGGGAAGTGGCTGG + Intronic
1062740995 9:138175288-138175310 GGTGGGGGTGGGAGAGTGGCTGG + Intergenic
1185459820 X:328849-328871 GGAGGGGGGAGGGGAGAGGTGGG - Intergenic
1185466672 X:358937-358959 GGCGGGGGTAGGGGAGGGCGGGG + Intronic
1185604951 X:1363399-1363421 GGCTGAGGCAGGAGAGTGGCGGG - Intronic
1185736560 X:2500669-2500691 GGCGGGGGTCGAGGTGTGGCCGG - Intronic
1185770693 X:2763475-2763497 GGCGGTGGGAGGGGGGTGGAAGG + Intronic
1186917933 X:14244043-14244065 GGAGGGGGTTGGGCAGTGCCTGG - Intergenic
1187898206 X:24002625-24002647 GGGTGGGGTAGGGGATTGGGGGG + Intronic
1188289724 X:28372142-28372164 GGCGGGGGGGGGGGGGGGGCGGG + Intergenic
1188302094 X:28517084-28517106 GGATGGGGTAGGGGAGTTTCTGG - Intergenic
1188669542 X:32866726-32866748 GGGGGGGGTGGGGGGGTGGGGGG + Intronic
1188919174 X:35950464-35950486 GGCTGAGGTAGGGGAATTGCTGG - Intronic
1189185558 X:39051922-39051944 GGAGGGGGCAGGGGAGAAGCCGG + Intergenic
1189834449 X:45005955-45005977 GGGGGGGGTGGGGGGGTGGGGGG - Intronic
1190050782 X:47146992-47147014 GGTGGGGGTAGGGGACTCTCAGG - Intronic
1190064945 X:47233322-47233344 TGCGGGGGCGGGGGAGTGGCCGG + Intronic
1190136521 X:47804253-47804275 GGCGGGGGTGGTGGAGGGGCAGG - Intergenic
1190245717 X:48688956-48688978 GGAGGGAGTGGGGGAGGGGCTGG - Exonic
1190249091 X:48708656-48708678 GGCTGGGGTCTGGGAATGGCAGG - Exonic
1190265689 X:48826365-48826387 GGCAGGGGCGGGGCAGTGGCAGG + Intergenic
1190320385 X:49176377-49176399 GGCAGGGGTCGGAGAATGGCAGG + Intronic
1190666946 X:52704839-52704861 GGTGGGGGTAGGGGGGTTGCCGG + Intronic
1190672472 X:52753569-52753591 GGTGGGGGTAGGGGGGTTGCCGG - Intronic
1190915519 X:54808715-54808737 GGCGTGAGTAGGGGAGGGGCCGG + Intronic
1191975682 X:66868705-66868727 GGAGGGGGTAGGAGAGGGGAGGG - Intergenic
1192175299 X:68881252-68881274 GGCTGGGGGAGGGGAGGGGAGGG + Intergenic
1192226456 X:69231508-69231530 GGAGGGGATGGGGGAGTGGAAGG + Intergenic
1193507170 X:82358984-82359006 GGCGGGGGAAGGGGAGGGAGGGG + Intergenic
1193754935 X:85397160-85397182 GGAGGGGGTAGAGGAGAGGTGGG - Intergenic
1193807281 X:86010191-86010213 TGGGGGGGTAGGGGGGTGGGGGG + Intronic
1194290332 X:92064137-92064159 GGTGGGGGTGGGGGACTGGCAGG + Intronic
1195074756 X:101316031-101316053 CGGGGTGGTAGGGGAGTGGAGGG - Intergenic
1195105453 X:101598853-101598875 GGCGGGGGTGGGGGAAGGGGAGG + Intergenic
1195107429 X:101614914-101614936 GGCGGGGGTGGGGGAAGGGGAGG - Intergenic
1195208550 X:102627571-102627593 GGTGGGGGCAGGGGTGTGGAGGG - Intergenic
1195318873 X:103705103-103705125 GGCGGGGGTAGCGGGGAGGGTGG - Intergenic
1195642204 X:107188427-107188449 GGCGGGGCTGGGGGAGTGGTGGG - Intronic
1195741872 X:108072949-108072971 GGCGGGTGGAGGGGGGCGGCTGG + Intronic
1196678210 X:118443008-118443030 GGGGCAGGGAGGGGAGTGGCGGG - Intronic
1197776008 X:130119208-130119230 GGAGGGGGTGGGGGAGTGGGAGG - Intergenic
1198135894 X:133749957-133749979 GGTGGGGGTAGGGGAATCACTGG - Intronic
1198210368 X:134510523-134510545 GGCGGGGGCTGGGGGGAGGCAGG + Intronic
1198533929 X:137568683-137568705 GGTGGGGGTGGGGGTGGGGCGGG - Intronic
1198591860 X:138192228-138192250 GGGGGGTGTAGGGTAGAGGCTGG + Intergenic
1198832344 X:140764359-140764381 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1198841858 X:140865588-140865610 AGCAGGGGTAGGGTGGTGGCAGG - Intergenic
1199111569 X:143941448-143941470 GGGGGGGGAGGGGGAGGGGCGGG + Intergenic
1199511042 X:148622811-148622833 GGCATGGGAAGGAGAGTGGCAGG - Intronic
1199600790 X:149540153-149540175 GGCGGGGCTCGGGGTGGGGCGGG - Intergenic
1199682832 X:150239353-150239375 TTCTGGGGTAGGGGACTGGCAGG + Intergenic
1199846293 X:151694949-151694971 GGCGGGGGCAGGGGCGGCGCCGG + Intergenic
1199858544 X:151779571-151779593 GATGGGGGCAGGGGAGTAGCTGG + Intergenic
1200005114 X:153080291-153080313 GGCGGGGGGGGGGGAGGGGGGGG - Intergenic
1200073932 X:153542064-153542086 GGCGGGGGTGGGGGAGGTGGGGG + Intronic
1200094359 X:153650324-153650346 GGTGGGGGTGGGGCAGGGGCCGG - Exonic
1200135172 X:153871244-153871266 GGTGGGGGCAGGGGGGTGGCGGG + Intronic
1200147779 X:153935304-153935326 GGCGGGGGTGGGGGCGGGGGAGG + Exonic
1200184400 X:154172759-154172781 TGCGGGGGTTGTGGATTGGCTGG - Intergenic
1200190052 X:154209892-154209914 TGCGGGGGTTGTGGATTGGCTGG - Intergenic
1200195805 X:154247701-154247723 TGCGGGGGTTGTGGATTGGCTGG - Intergenic
1200201459 X:154284817-154284839 TGCGGGGGTTGTGGATTGGCTGG - Intronic
1200229429 X:154436822-154436844 GGCGGGGGTGGGGAGGTGGGCGG + Intergenic
1200283598 X:154799926-154799948 GGCGGGGGGCGGGCGGTGGCGGG + Intronic
1200607846 Y:5288741-5288763 GGTGGGGGTGGGGGACTGGCAGG + Intronic
1200756340 Y:6993542-6993564 GGCTGGTGTAGGGGTGTGGGGGG - Intronic
1201270893 Y:12252742-12252764 GGTGGGGGGATGGAAGTGGCGGG - Intergenic
1201328805 Y:12796560-12796582 GGAAGGGGTGGGGGAGGGGCAGG + Intronic