ID: 1152638500

View in Genome Browser
Species Human (GRCh38)
Location 17:81439880-81439902
Sequence GCTGAGGGGCAGCCAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152638500_1152638509 7 Left 1152638500 17:81439880-81439902 CCCTCTCTTGGCTGCCCCTCAGC 0: 1
1: 0
2: 5
3: 34
4: 385
Right 1152638509 17:81439910-81439932 CCCCACCTCATACTCACTCCAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1152638500_1152638513 19 Left 1152638500 17:81439880-81439902 CCCTCTCTTGGCTGCCCCTCAGC 0: 1
1: 0
2: 5
3: 34
4: 385
Right 1152638513 17:81439922-81439944 CTCACTCCAGGACCTCTGTGTGG 0: 1
1: 0
2: 2
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152638500 Original CRISPR GCTGAGGGGCAGCCAAGAGA GGG (reversed) Intronic
900286207 1:1901784-1901806 GGTAAGGGGCAGCCCAGAGATGG + Intergenic
900323625 1:2096777-2096799 GGTCAGGGGCAGCCAAGGGAAGG + Intronic
900940703 1:5796777-5796799 GGGGAGGGGCAGCCAGGATAGGG - Intergenic
901344735 1:8529930-8529952 GCTTAAGGGCATCCCAGAGAGGG + Intronic
901642577 1:10700361-10700383 GCTGGGGAGAAGCCAAGGGAGGG + Intronic
901700733 1:11043731-11043753 GCTGAGGGGCCGCTTAGAGAGGG + Intronic
902768779 1:18633686-18633708 GCTGAGGCACAGCCGAGGGACGG - Intronic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
904049884 1:27632757-27632779 GTCCAGGGGCAGCCAAGGGATGG + Intronic
904078453 1:27857203-27857225 GCAGAGGGGCCACCATGAGAGGG + Intergenic
904997351 1:34641355-34641377 TCTGAGTGGCAGCCCAGAAAAGG + Intergenic
905488798 1:38327542-38327564 GCTGACTGGCATGCAAGAGATGG - Intergenic
906704884 1:47887725-47887747 GCTGAAGAGCAGCGAAGAAAGGG + Intronic
907412086 1:54290103-54290125 GCTGAGGTGTGGCCAAGAGCTGG - Intronic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
907949098 1:59163796-59163818 GCTGTGGGGAAGCCAAGAATAGG - Intergenic
908794909 1:67821459-67821481 GCTAAGAGGCAGCAAAGAGCCGG + Intronic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
912058627 1:105636333-105636355 GCTGAGGGACAGCAAGGAGGAGG - Intergenic
912482352 1:109993020-109993042 GCTGAGGAGCATCCCAAAGAGGG - Intronic
913602747 1:120437728-120437750 ACTGAGGGACAGACAAGACAAGG - Intergenic
913603495 1:120444081-120444103 ACTGAGGGACAGACAAGACAAGG - Intergenic
913969710 1:143405464-143405486 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
914064083 1:144231057-144231079 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
914115067 1:144735297-144735319 GCTGAGGCTCAGCCATGAGGAGG + Intergenic
914222798 1:145695527-145695549 GTTGAAGGACAGCCAACAGAAGG + Intronic
914950708 1:152111011-152111033 GCAGAGGCGCCGCCAAGAGCAGG - Exonic
914970380 1:152304165-152304187 GCTCAGGAGCAGTCAAGAGATGG - Exonic
914970694 1:152306109-152306131 GCTCAGGAGCAGCTAAGAGATGG - Exonic
914970849 1:152307081-152307103 GCTCAGGAGCAGCTAAGAGATGG - Exonic
914971010 1:152308053-152308075 GCTCAGGAGCAGTCAAGAGATGG - Exonic
914971166 1:152309028-152309050 GCTTGGGAGCAGTCAAGAGATGG - Exonic
914971637 1:152311944-152311966 GCTCAGGAGCAGTCAAGACATGG - Exonic
914971791 1:152312919-152312941 GCTCAGGAGCAGTCAAGAGATGG - Exonic
915091346 1:153428529-153428551 GGTGAGAGGCAGCCCTGAGAAGG + Intergenic
915093766 1:153444759-153444781 GGTGAGAGGCAGCCCTGAGATGG - Intergenic
915112103 1:153570598-153570620 GCAAAGGGGAAGCCAAGAGGAGG - Intergenic
918058759 1:181044746-181044768 CCTGAGGGGTGGCCAAGAGGTGG + Intronic
918097318 1:181345987-181346009 TCTGAGGGGCAGGCCATAGATGG + Intergenic
919745766 1:201008364-201008386 GCTGAGGGGGAACCCAGAGAAGG + Intronic
919814989 1:201431568-201431590 CCTGATGAGCAGCAAAGAGATGG - Intergenic
920065816 1:203268928-203268950 GCAGGGAGGCAGCCACGAGAGGG - Intronic
920078767 1:203356730-203356752 GCAGAGGGGCTGCCATGTGATGG + Intergenic
920963066 1:210681187-210681209 GTTAGGGGGCAGCCAACAGATGG + Exonic
921048006 1:211491054-211491076 GCAGAGGTGCAGCCAGGAGAGGG + Intronic
921093031 1:211860914-211860936 GATGAGTGGTTGCCAAGAGAAGG - Intergenic
922593972 1:226799409-226799431 GCTGAGGGACAGCCAGGAGAAGG + Intergenic
924729111 1:246696073-246696095 GGTGTGGGGCAGCCAAGCCAAGG - Intergenic
1062894872 10:1095543-1095565 GCTGGGTGGCAGTGAAGAGAAGG + Intronic
1064037513 10:11926616-11926638 GCTGAGATGAGGCCAAGAGATGG + Intronic
1064350794 10:14574537-14574559 TCTGATGGGCTGCCAAGAGGTGG - Intronic
1065293754 10:24255719-24255741 GCTGAGGATAAGCCAAAAGAGGG + Intronic
1066678536 10:37913874-37913896 GGTGAGGCCCAGCCAAGAAAAGG - Intergenic
1066756296 10:38716155-38716177 ACTGAATGGCTGCCAAGAGATGG + Intergenic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1069835381 10:71304674-71304696 GTTGAGGGACAACCAGGAGAAGG + Intergenic
1070130284 10:73651142-73651164 CTTGTGGGGCAGCCCAGAGAAGG - Intronic
1071424282 10:85532836-85532858 GCTTAGGAGCAGCTTAGAGAGGG - Intergenic
1072202741 10:93175862-93175884 GCTGAGGGTCTGTCAAGAGGGGG + Intergenic
1072227913 10:93387268-93387290 GCAGAGGGGCATCCATGAGCTGG + Intronic
1072632277 10:97154634-97154656 GCTGGTTGGCAGCCAACAGAGGG - Intronic
1073158075 10:101364507-101364529 GTTTAGGTGCAGCGAAGAGATGG - Intronic
1073490514 10:103850224-103850246 GCAGAGGGGAAGGGAAGAGAAGG - Intronic
1075038343 10:119087857-119087879 GCTGAGTGGTGGCCAAGTGAAGG - Intergenic
1075654066 10:124149795-124149817 GCTGAAGGGCTGGCAAGAGGAGG + Intergenic
1076533884 10:131163480-131163502 GGTCAGAGGCAGCCAAGAGAGGG + Intronic
1076540121 10:131208363-131208385 GCTGAGGAGCAGCCATGTTAAGG - Intronic
1077273530 11:1692847-1692869 GCTGAGGAGCAGGAAGGAGATGG + Intergenic
1077339179 11:2018415-2018437 GGTGAGGGGCTGCTCAGAGACGG + Intergenic
1077662283 11:4080344-4080366 TCTGATGGGAAGACAAGAGATGG - Intronic
1078639875 11:13084572-13084594 AGTGAGGGGCACACAAGAGAAGG - Intergenic
1078894563 11:15586573-15586595 TCTGAGGGGCAGCCATAAGTGGG - Intergenic
1080626619 11:34036214-34036236 CCAGAAGGGCAGCTAAGAGATGG - Intergenic
1080643673 11:34173307-34173329 CCTGTGGGGCAGCAGAGAGAGGG + Exonic
1081693159 11:45092073-45092095 GCAGGAGGGCAGGCAAGAGACGG - Intergenic
1081841351 11:46203725-46203747 GCTGAGAACCAGGCAAGAGAAGG + Intergenic
1082810806 11:57477723-57477745 GCAGTGTGGCAGCCAAGAGTGGG + Intergenic
1083224550 11:61276680-61276702 CCTGAGGAGGAGGCAAGAGAGGG + Exonic
1083628139 11:64082420-64082442 GGTGAGGGGCAGGCAGGTGAGGG + Intronic
1084163927 11:67366399-67366421 GCTGAGGGGCTGGGGAGAGACGG + Intronic
1084229861 11:67743750-67743772 GCTGAGATGCAGCCACCAGATGG + Intergenic
1084371944 11:68750775-68750797 AGGGAGGGGCAGCCAAGGGAGGG + Intronic
1084372010 11:68750934-68750956 GGTGAGGGGCGGCCAGGTGAGGG + Intronic
1084372091 11:68751135-68751157 GGTAAGGGGCGGCCAGGAGAGGG + Intronic
1084372135 11:68751233-68751255 GGTGAGGAGCAGCCAGGGGAGGG + Intronic
1085397004 11:76211465-76211487 GCTCAGGGGAGGCCAAGTGAGGG - Intergenic
1086961388 11:92982616-92982638 GATGAGGGTCAGCTATGAGAAGG - Exonic
1087621195 11:100544453-100544475 GCTGAGGGGCACCCTAGGAAAGG + Intergenic
1088226247 11:107623376-107623398 GCTGAGGGAAAGCCAAGGGGCGG - Intronic
1088640832 11:111871374-111871396 GCTGCTGGGCAGCCGAGAGGCGG - Intronic
1088884718 11:113997822-113997844 GCTGAAGAGTAGCCCAGAGAAGG - Intergenic
1089130471 11:116208208-116208230 GCGGAGGGGGAGCAGAGAGAGGG - Intergenic
1089160351 11:116432469-116432491 TCAGAGAGGAAGCCAAGAGAAGG - Intergenic
1090414092 11:126528837-126528859 GGTGAGGGGCAGCATGGAGAGGG + Intronic
1202822163 11_KI270721v1_random:73597-73619 GGTGAGGGGCTGCTCAGAGACGG + Intergenic
1092208729 12:6632729-6632751 CCTGAGGGGCAGGGATGAGATGG + Intronic
1103763323 12:123266309-123266331 GCAGAGGGGCAGCCGGGAGTTGG - Intronic
1103853132 12:123946361-123946383 GCAGAGGAGGAGCCATGAGAGGG - Intronic
1103899400 12:124295506-124295528 GCTGGGGGGCAGCCCGGAGTCGG - Intronic
1104411494 12:128561958-128561980 GCAGTGGGGCAGAGAAGAGATGG + Intronic
1105344056 13:19557506-19557528 GCTGAAAGGCAGCTTAGAGACGG + Intergenic
1105535979 13:21264077-21264099 GCTGAAAGGCAGCTTAGAGACGG - Intergenic
1105950782 13:25228009-25228031 GATGAGGGTCAGCCATCAGATGG - Intergenic
1106389254 13:29319385-29319407 TCTGAGGATGAGCCAAGAGAGGG - Intronic
1110714290 13:78683870-78683892 GCAGAGGGGAAGAGAAGAGAAGG + Intergenic
1113539333 13:111093976-111093998 GCTGAGGTGCCCCCATGAGAAGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1113634549 13:111910586-111910608 GCTGAGGGGCCACCCAGGGAGGG + Intergenic
1114683994 14:24510589-24510611 GATGTGGGGCAACCAAGTGATGG + Intergenic
1114866350 14:26598594-26598616 GATGAGGGGCAGCGAAGGGGTGG + Intergenic
1115025995 14:28746936-28746958 GAGGAGGTGGAGCCAAGAGAGGG - Intergenic
1115478781 14:33841557-33841579 GGAGAGGGGCAGGCAAAAGATGG - Intergenic
1116658497 14:47678385-47678407 GCTTAAGGACAGGCAAGAGATGG + Intergenic
1118987870 14:70772110-70772132 GCTGCGGTGCTGCCTAGAGATGG + Intronic
1119387352 14:74265962-74265984 GCTAACAGGCTGCCAAGAGATGG + Intergenic
1119639991 14:76307785-76307807 GCTGAGTGGCAGCCTAAAGGTGG + Intergenic
1120848658 14:89148895-89148917 GCTTAGGGGCAGGCATCAGATGG - Intronic
1121256573 14:92534702-92534724 GCTGAGGGGCAGCCAGGCAGGGG + Intronic
1121562724 14:94886890-94886912 GCTGAGGGAAAGCCAGGAGGTGG - Intergenic
1122312124 14:100804064-100804086 ACTGAGGGGCAGCCCAGAGATGG - Intergenic
1123004898 14:105316422-105316444 TCAGAGGGGCAGACAGGAGAAGG - Intronic
1123440557 15:20288219-20288241 ACTGAAGGGCTGCCAAGAGATGG + Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1126108325 15:45161555-45161577 GCTGAGGGTCAGCCAGGCAAGGG - Intronic
1127262151 15:57334469-57334491 GTGGAGGGGAAGCCAGGAGAGGG + Intergenic
1128025205 15:64430253-64430275 GCAGAGGATCAGCCTAGAGAAGG + Intronic
1128236180 15:66068895-66068917 AGTGAGGGGCACCCAAGAGCAGG - Intronic
1129170428 15:73804242-73804264 GTCGAGGGGCTGCCAGGAGAAGG - Intergenic
1129185297 15:73902467-73902489 GCTGAGAGGCAGAGAAAAGAGGG - Intergenic
1130295673 15:82646244-82646266 CCTGAGGGGCAGCCAAGAGGCGG + Intronic
1130540548 15:84818010-84818032 GCTGGGGGGCTGCCCAGAGTAGG + Intronic
1130702879 15:86203162-86203184 GCTGAGGGGAATCCAAAAGTTGG + Intronic
1130966243 15:88699964-88699986 GCAGAGGGCCAGCCAAGGGCTGG + Intergenic
1131057381 15:89383717-89383739 GAGGAGGGGCAGCCAGGAGAGGG - Intergenic
1131544291 15:93302782-93302804 GATAAGAGGCAGCCAAGAGTTGG - Intergenic
1132552253 16:558367-558389 GAAGAGGGGCAGCCTCGAGAGGG - Intergenic
1133349647 16:5093101-5093123 CCTGTGGGGCAACCCAGAGACGG + Intronic
1133720212 16:8487764-8487786 TCAGAGGGGGAGCCAATAGAAGG + Intergenic
1134311955 16:13083103-13083125 GGGGAGGGGCAGCCAACAGTGGG + Intronic
1136026076 16:27469868-27469890 GGGGAGGGGCAGGGAAGAGAAGG - Intronic
1136082284 16:27860120-27860142 GCTGAGAAACAGGCAAGAGAGGG + Intronic
1136381430 16:29897865-29897887 GCTGAGGAGGGGCCCAGAGATGG - Exonic
1136683543 16:31981495-31981517 GATGAGGGGCAGCCTGGGGAGGG + Intergenic
1136726379 16:32360713-32360735 ACTGAAGGGCTTCCAAGAGATGG - Intergenic
1136784174 16:32925055-32925077 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1136844624 16:33566226-33566248 ACTGAAGGGCTGCCAAGAGGTGG - Intergenic
1136885610 16:33928751-33928773 GGTGAGGGGCAGCCTGGGGAGGG - Intergenic
1137581245 16:49634787-49634809 GCTGAGGGGCAACCAATGGTGGG - Intronic
1138272127 16:55702856-55702878 GCTGAGGTTCAGACATGAGAGGG - Intronic
1138555095 16:57766300-57766322 GTTGAGGGGCTTCCCAGAGAAGG - Intronic
1138565114 16:57827509-57827531 TCTGAGGGACAGGCAGGAGAAGG - Intronic
1138614854 16:58157235-58157257 GCAAAGGGGCAACCAAGAAAGGG + Intergenic
1139198059 16:64944248-64944270 GCAGAGGGTGAGCCAAGAGGTGG + Exonic
1139613015 16:68072467-68072489 CTTGAGGAGCTGCCAAGAGATGG - Intronic
1139703793 16:68726374-68726396 ACTCCGGGGCAGCCAAGAGAAGG - Intergenic
1140230716 16:73115133-73115155 GATGAGGGGCAGCCAGGATCAGG - Intergenic
1140730407 16:77851094-77851116 ACTGTGGGGCAAGCAAGAGATGG + Intronic
1141131543 16:81441018-81441040 GCTGAGGGGCAGCCTAGGAGAGG - Intergenic
1141703105 16:85651390-85651412 GCTGGGGGGCAGCCAGCAGGCGG - Intronic
1141877858 16:86838472-86838494 GATGAGGGCCAGCTAGGAGAGGG - Intergenic
1141941280 16:87277833-87277855 GCTGCGGGGCAGCCTGGAGGAGG - Intronic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1203000054 16_KI270728v1_random:157044-157066 ACTGAAGGGCTTCCAAGAGATGG + Intergenic
1203086829 16_KI270728v1_random:1189061-1189083 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1203131654 16_KI270728v1_random:1693445-1693467 ACTGAAGGGCTTCCAAGAGATGG + Intergenic
1203154792 16_KI270728v1_random:1866524-1866546 ACTGAAGGGCTGCCAAGAGGTGG - Intergenic
1142498781 17:320935-320957 GCTGTGGTTCAGCCAAGGGAGGG - Intronic
1142669139 17:1479494-1479516 GCTGAGGAGCTGCCAAGGGCAGG + Exonic
1142876793 17:2856103-2856125 GCTGAAGGGCAGAAAACAGAAGG - Intronic
1143098101 17:4489263-4489285 GCTGGGGGGCACCCCACAGAAGG - Intergenic
1143405650 17:6675569-6675591 GCTGAGGCACAGCCAGGAGCAGG - Intergenic
1143526872 17:7478252-7478274 GATCATGGGCAGCCAAGCGAGGG - Intronic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1145934111 17:28705120-28705142 GTTGAGGGGCAGGCAGGAGCTGG - Intronic
1146536985 17:33661157-33661179 GCTCAGCACCAGCCAAGAGAGGG - Intronic
1147144457 17:38477202-38477224 GATGAGGGGCAGCCTGGGGAGGG + Intronic
1147162346 17:38575555-38575577 GCAGAGGGACAGCCAAGAATTGG - Intronic
1147187976 17:38722833-38722855 GATCAGGGCCAGCCAGGAGAGGG + Intronic
1147572455 17:41579792-41579814 GCTGAGCGGAGGCCAAGGGAAGG + Intergenic
1147689400 17:42306219-42306241 CCTGAGAGGGAGACAAGAGAGGG - Exonic
1147848061 17:43419243-43419265 GCTGAGGGGCAGCAGAGAGAGGG + Intergenic
1147993495 17:44349296-44349318 GCTGAGGGGCACTCACCAGAAGG - Exonic
1148169354 17:45506185-45506207 GCTGAGAAGAAGCCAAGACAAGG - Intergenic
1148549967 17:48544475-48544497 GGTGAGGGGCAGCTAGAAGAGGG - Intronic
1149658783 17:58324015-58324037 GCTTGGGGGAAGCCAGGAGAAGG - Intronic
1150004351 17:61460643-61460665 GATGTGGGGAGGCCAAGAGAGGG - Intronic
1150142862 17:62744632-62744654 GTGGAAGGGCAGTCAAGAGAAGG + Intronic
1150795746 17:68235432-68235454 GCTGAGGGCCACCCAGGAGCTGG + Intergenic
1151768227 17:76143087-76143109 GCTAAATGACAGCCAAGAGAAGG + Exonic
1151788269 17:76287248-76287270 GTTGAGGGAGAGCCAAGACAGGG - Exonic
1152390436 17:80001017-80001039 GCTGAGGGGCAGCCAGGGAGGGG + Intronic
1152559564 17:81071201-81071223 GCTGGAGGGCAGCAGAGAGAAGG + Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152829179 17:82486629-82486651 GCTGAGGAGCAGCCGGGAGGTGG + Intronic
1152836849 17:82538793-82538815 ACTGAGGCCCAGCCCAGAGAAGG + Intronic
1155128348 18:22903026-22903048 ACTGAGTGGCAGAGAAGAGAAGG + Intronic
1156845012 18:41655753-41655775 GCTTAGTGGCAGCTAAGCGAGGG + Intergenic
1157116214 18:44864833-44864855 GTTGAGGGGGATCCAAGACAGGG - Intronic
1157603843 18:48913288-48913310 GCTGAGGAGCAGGCAAGGGCAGG + Intergenic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1158338707 18:56441921-56441943 GCTGAGGGAAAGCAAAGAAATGG + Intergenic
1158536891 18:58316272-58316294 GCTGAAGTGCAGAAAAGAGAGGG - Intronic
1160159931 18:76463343-76463365 TGTGAGGGGCAGCCAGGAGCAGG + Intronic
1161583444 19:5092828-5092850 GCTGAGGAACAGCCATGAGCCGG - Intronic
1161725701 19:5927297-5927319 TCTGGAGGGCAGCCAAGAGGTGG + Intronic
1161950190 19:7463567-7463589 GCTGTGGGGCAGCCATGGGGAGG - Intronic
1162180167 19:8863295-8863317 GCTGAGGGACATCCAGGACAAGG - Exonic
1162839994 19:13349349-13349371 CCTTGGGGGCAACCAAGAGAGGG + Intronic
1163263552 19:16205360-16205382 GCTGAGAGGCACCCATGAGAAGG + Intronic
1164743384 19:30593668-30593690 GGTGAGGGGCAGGGAGGAGAGGG - Intronic
1164787221 19:30943065-30943087 GGTGAGGGGCAGACAGGACAAGG + Intergenic
1165117438 19:33537384-33537406 CCAGAGGGGCAGTCAGGAGAAGG - Intergenic
1165810617 19:38609679-38609701 GCAGAGGGGCAGCCACGTCAGGG + Intronic
1166334170 19:42095513-42095535 GGTGAGGGCCACCCAGGAGAGGG + Intronic
1166661994 19:44653496-44653518 GCTGAGCAGCAGCCTAGAGCAGG + Intronic
1166980628 19:46630091-46630113 GGTGAGGTGCAGCCACCAGAAGG - Intergenic
1167345075 19:48940392-48940414 GCTGAGTGGAAGCCAAGGCAAGG - Intronic
1167454522 19:49591445-49591467 GCGGAGGGGCGGGCAAGGGAGGG - Intergenic
1167749333 19:51370508-51370530 CCTGAGGGGCAGCCAGGAGCAGG - Intergenic
1167946380 19:52992394-52992416 GGAGAGGGGCAGCAAAGAGGGGG - Intergenic
1168153292 19:54460459-54460481 GCTGAGGGGCAGGGACCAGATGG - Intronic
926056939 2:9779222-9779244 AGTGAGAGGCAGCCAAGAGAAGG - Intergenic
926692832 2:15748955-15748977 GCCAGGGGGCAGCCAAGAGGAGG - Intergenic
926724939 2:15990254-15990276 GCAGAGGGGCAGGGAGGAGAAGG + Intergenic
927952679 2:27183652-27183674 GGAGAGGAGGAGCCAAGAGAGGG - Intergenic
927996790 2:27492602-27492624 CCTGAGGGGCAGCCAGGGAAAGG - Intronic
928336204 2:30400592-30400614 GCCTAGGGGTAGCCAAGAGGAGG + Intergenic
928362385 2:30675924-30675946 GTTAGAGGGCAGCCAAGAGAGGG - Intergenic
928404268 2:31002631-31002653 TCCAAGGGCCAGCCAAGAGAGGG + Intronic
929207588 2:39314738-39314760 TCTTAGGGGCAGCCAAGTTATGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932438854 2:71719126-71719148 GCTGAGGAGCAGCCAGGACCTGG - Intergenic
932441288 2:71737178-71737200 GCTGGGGGGCAGCCAAGCTCTGG - Intergenic
934174404 2:89566375-89566397 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
934284720 2:91640725-91640747 GCTGAGGCTCAGCCATGAGGAGG - Intergenic
934319593 2:91960403-91960425 ACTGAAGGGCTGCCAAGAGATGG + Intergenic
935982437 2:108640532-108640554 ACTGAGGGACAGCCCAGAGAAGG - Intronic
936016383 2:108962138-108962160 GCTGAGAGGCTGCCTAGACAGGG - Intronic
936697763 2:114970938-114970960 GCTGAGGAGCAGCAACAAGAAGG + Intronic
938105995 2:128530212-128530234 TCTGAGGGGCAGCCCAGTGTGGG + Intergenic
940623905 2:156148903-156148925 GGTGAGCGGCAGGCAAGTGAGGG + Intergenic
944168681 2:196750833-196750855 GCTGAGGGGCTGTCAGGAAATGG - Intronic
944928672 2:204493251-204493273 GCTGAGTGAAAGCCTAGAGATGG - Intergenic
945773601 2:214077575-214077597 GCACAGGGGCAGCCAAGGGGAGG - Intronic
946174964 2:217916946-217916968 GCTGAAGGGCAGGCAACAAATGG + Intronic
948712487 2:239833677-239833699 GCAGAGGGGCAGCAATGAGCAGG + Intergenic
948832842 2:240606685-240606707 GCTGAGGGTCAGCCAAGGGCAGG + Intronic
949047344 2:241877958-241877980 GTTGGGGGGCGGCCAGGAGAGGG - Intergenic
1168836754 20:882598-882620 GCTGAGGGGGTGCCAACAGGTGG - Intronic
1169386795 20:5156753-5156775 CATGAGGGGGAGCCAAGAGATGG - Intronic
1169829051 20:9802823-9802845 GCTAAGTGGCAACCAACAGAAGG + Intronic
1170663593 20:18365742-18365764 GCTGAGAGGCAACCACGTGAGGG - Intergenic
1170864548 20:20141931-20141953 GAGGAGGGGCAGCCATGAGCAGG + Intronic
1171365262 20:24618281-24618303 CCTGAGGGACAGCCCAGGGAAGG + Intronic
1172289603 20:33766591-33766613 TCTGAGGGGAAGGCCAGAGAGGG + Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1172966593 20:38839993-38840015 TCTATGGGGCAGCCAAGTGAGGG + Intronic
1173368860 20:42416546-42416568 ACTTAGGGGCAGCAAATAGAAGG - Intronic
1175846238 20:62060412-62060434 GCTTAGTGGCAGCCAGGAGTCGG - Intronic
1175948307 20:62568980-62569002 GCTGAGGGGTAGGGAGGAGAGGG - Intronic
1179933898 21:44590722-44590744 CCTGGGGGGCAGCCATGAGCTGG + Intronic
1180307843 22:11144448-11144470 ACTGAAGGGCTGCCAAGAGATGG + Intergenic
1180546319 22:16506261-16506283 ACTGAAGGGCTGCCAAGAGATGG + Intergenic
1181631700 22:24155099-24155121 GCTGAGGGGAGGCCAAGGAAAGG - Intronic
1181725183 22:24806398-24806420 GCCGCGGGTCAGCCGAGAGAGGG - Intronic
1182162354 22:28135507-28135529 GCTGTGTGGCAGACAGGAGAAGG + Intronic
1182212873 22:28691118-28691140 ACTGAAGGGCTGCCAAGAGATGG - Intronic
1182548515 22:31089158-31089180 GGTGAGGGGCAGCCCTGGGACGG - Intronic
1183282235 22:36938002-36938024 TCTGAGGGGAGGCCCAGAGAGGG - Exonic
1183521724 22:38299500-38299522 GCTGTGGGGCAGCCCAGTGTGGG + Intronic
1183522048 22:38301080-38301102 ACTAAGGGGCAGGCCAGAGAAGG + Intronic
1183564186 22:38601412-38601434 GCTGAGGGGCAGAAATGAGGTGG + Intronic
1184004665 22:41699520-41699542 GCTGAGGGCAAGCGAGGAGATGG + Exonic
1184636953 22:45840390-45840412 GCCGAGGGGTAGCTAAGACAGGG + Intronic
950345241 3:12287625-12287647 GCTGGGAGGCGGCCCAGAGAGGG - Intronic
950575839 3:13831682-13831704 GCTGGGGGGCTGCCCAGGGAGGG - Intronic
951067446 3:18283631-18283653 GCTGAGTGGCAACCTAGAGTGGG + Intronic
951614428 3:24525466-24525488 GCTGAGTTCTAGCCAAGAGAAGG - Intergenic
952163892 3:30724740-30724762 GCAGAAGGAAAGCCAAGAGAGGG - Intergenic
952180264 3:30909674-30909696 GCTGAGGGGCAAAAAAGTGAGGG + Intergenic
952665157 3:35895250-35895272 GCTGTGCGGCAGTCAAGAGTAGG + Intergenic
953308844 3:41857096-41857118 GCTGAGTTTCAGTCAAGAGAGGG - Intronic
953637656 3:44676526-44676548 GATGAGGGACAGCCCAGGGAGGG + Intergenic
953771559 3:45781812-45781834 GCTGAGGTCCAGAGAAGAGAAGG + Intronic
954380061 3:50214567-50214589 GCTGAGGGACAGTCAGGGGAAGG + Intronic
954541568 3:51396353-51396375 GTTGAGGGCCAGGAAAGAGAAGG - Exonic
954663799 3:52239665-52239687 TGTGAGGGGCTGCCAGGAGAAGG + Intergenic
954718132 3:52537145-52537167 GGTGAAGGGCAGGCATGAGAGGG - Intronic
954749753 3:52806787-52806809 GCTGAGGGGCAGCAGAGCGGGGG - Intronic
954897261 3:53986486-53986508 GATGAGGAGCAGGCAAGATAGGG + Intergenic
956692634 3:71891880-71891902 GCCGAGGGGCAGCCAGAAGTGGG + Intergenic
957691764 3:83580054-83580076 GGTGAGAGGAAGTCAAGAGAAGG + Intergenic
957916454 3:86693698-86693720 GCTCAGAGGGAACCAAGAGAGGG - Intergenic
958765560 3:98363045-98363067 TCCGAGGGGCAGGCAGGAGATGG + Intergenic
959289072 3:104449633-104449655 CCTGAGGGCCAGCCTAGAGCTGG - Intergenic
960533221 3:118788375-118788397 GATGAGGGGAGGGCAAGAGAAGG - Intergenic
961081881 3:124034166-124034188 GGGGAGGGGGAGCCAAGGGAGGG - Intergenic
961306388 3:125960958-125960980 ACTGTGGGGAAGCCAGGAGAAGG - Intergenic
961671755 3:128537349-128537371 GCTGAGGAGCAGCCCAGGGCTGG + Intergenic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962987234 3:140546802-140546824 GCAAAGGTGCAGCCACGAGATGG + Intronic
963934930 3:151042751-151042773 GGTGGTGGGCAGGCAAGAGAAGG - Intergenic
964572751 3:158128170-158128192 TCTGAGGGCCACCCAAGGGATGG - Intronic
965634893 3:170770883-170770905 GATGAGGGGCAGGAAAGGGAGGG + Intronic
967101695 3:186221213-186221235 GCTGAGGGGCAGGCAAGGCCAGG + Intronic
967875811 3:194267885-194267907 GTTGAGGCCCAGCCCAGAGAGGG + Intergenic
968923694 4:3535936-3535958 GCAGAGCGGCAGCCAGGACAAGG + Intergenic
968996759 4:3950756-3950778 CCTGTGGGGCAACCCAGAGATGG + Intergenic
969104509 4:4795306-4795328 GCTGAAGGGCAGCAAAGCCAAGG - Intergenic
969319806 4:6404850-6404872 GCTAAGAGGCAGGCAAGGGAGGG + Intronic
969613965 4:8241740-8241762 GCTGAGGGGCAGCCCAGAAAAGG - Intronic
969719841 4:8887562-8887584 TCTGAGGGGCAGCCCAGGCAGGG + Intergenic
969828257 4:9775318-9775340 GCTGAGGCTCAGCCATGAGGAGG - Intronic
970006704 4:11418094-11418116 GCAGAGGGGCTGAGAAGAGAGGG - Intronic
970276429 4:14405847-14405869 GCAGAGGAGCAGCACAGAGAGGG - Intergenic
972050415 4:34725522-34725544 GATGAGGTGGAGTCAAGAGATGG - Intergenic
972718234 4:41670082-41670104 GCTGAGAGGCAGCTAAGAAAAGG - Intronic
974402374 4:61424306-61424328 GCTGTGCGGCAGTCAAGAGTAGG - Intronic
976184693 4:82431596-82431618 GCTGAGGTGCAGACAAGTGCTGG - Intronic
977810218 4:101348105-101348127 GGTGAGAGGCAGCCCTGAGAGGG + Intronic
978066071 4:104404479-104404501 GCGGAGGCGTAGCCAACAGATGG - Intergenic
978480791 4:109188223-109188245 CATGAGGAGCATCCAAGAGAGGG - Intronic
979081566 4:116350245-116350267 GCTGAGGAACAGCAAAAAGAGGG + Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
982867962 4:160541648-160541670 GGTGAGGGGCATGCAAGTGAAGG - Intergenic
985644789 5:1079802-1079824 GCCAAGGGTCAGCCCAGAGACGG + Intronic
985717699 5:1471898-1471920 GATGAGGAGCACCCAGGAGAGGG + Intronic
986297319 5:6449756-6449778 ATTGAGGAGCAGACAAGAGAGGG - Intronic
986402939 5:7396581-7396603 GCCGAGGGGCAGCCCGGAGCGGG - Intronic
986970951 5:13335903-13335925 GTTGAGAGGAATCCAAGAGAGGG - Intergenic
987143434 5:14967869-14967891 GCTGAGGGTGAGGCTAGAGATGG - Intergenic
988033542 5:25796963-25796985 ACTAAGGGGCAGCCATGGGATGG + Intergenic
988725555 5:33922893-33922915 GCTGTGGGGCAGCCTAGAGGTGG - Intergenic
989201834 5:38771732-38771754 GCTGAGAGGCAGCCTATAGCTGG - Intergenic
995250799 5:109991278-109991300 GCAGAGAGGCAGCTTAGAGAAGG + Intergenic
995739116 5:115335928-115335950 GCTGATCTGCAGCCCAGAGAGGG - Intergenic
996068695 5:119109349-119109371 GAAGAGGGGCAGTCAACAGATGG - Intronic
998372425 5:141670490-141670512 GGTGAGGGGGAGCCAAGGGATGG - Exonic
999310781 5:150550592-150550614 GATGAGGGGACCCCAAGAGAAGG + Intronic
1001237405 5:170041958-170041980 GCCGAGAGGCTGCCAAGAGCAGG - Intronic
1001424646 5:171615368-171615390 GCTGCCGGGCAGCAAAGGGAAGG - Intergenic
1004999817 6:21229636-21229658 GCGGAGGGGCAGCCCAGAGGCGG - Intronic
1005689353 6:28287237-28287259 GATGAGTGTGAGCCAAGAGAAGG - Intronic
1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG + Exonic
1006935725 6:37716150-37716172 GATGTTGGGCAGCCAAGAGGTGG - Intergenic
1007229541 6:40338683-40338705 GCAGAGATGCAGCCACGAGAGGG - Intergenic
1007271504 6:40640934-40640956 GCTGTGAGGCAGGCGAGAGAAGG + Intergenic
1007713641 6:43840411-43840433 ACTCAGGGGCCTCCAAGAGAAGG - Intergenic
1007779855 6:44246539-44246561 GCTGAGGGGCAGCTCAGCGTAGG - Intronic
1008074464 6:47131471-47131493 GCTGAGGGGCAGCAATGGGGTGG - Intergenic
1008176345 6:48271759-48271781 GCTGATGAGCAGCCAAAAAAGGG + Intergenic
1008876056 6:56329356-56329378 GCTGTGGGGGAGGAAAGAGATGG + Intronic
1010602858 6:77852143-77852165 GCTGAGGCTCAGCTAAGAGAGGG - Intronic
1012553151 6:100482523-100482545 TATGAGGGGCAGCAAAGTGAGGG + Intergenic
1013429067 6:110039940-110039962 GCTGAGGGGAAGTAAAGAGAGGG - Intergenic
1015053245 6:128868253-128868275 GCTGAGGTGGAGAGAAGAGATGG - Intergenic
1015303443 6:131679942-131679964 GCTAAGAGGAAGCCCAGAGAAGG + Intronic
1018064670 6:160116747-160116769 GCTCAGCTGCTGCCAAGAGAGGG - Intergenic
1018100866 6:160438428-160438450 TCTGAGGACCAGCCAAGAAATGG + Intronic
1018317339 6:162569757-162569779 GCTCTGGGGCAGCCACCAGAGGG - Intronic
1018427678 6:163698287-163698309 GCTGACAGGAAGCAAAGAGAAGG + Intergenic
1018768817 6:166955427-166955449 GCGGAGGGCGAGCCAAGGGAAGG + Intronic
1018831281 6:167445544-167445566 GATGAGGGGCTTCCCAGAGAGGG - Intergenic
1018911400 6:168102334-168102356 GCTGAGAGAGAGCAAAGAGAGGG + Intergenic
1018964792 6:168475900-168475922 ACTGAGGGGCAGGCAGGAGCAGG + Intronic
1018994911 6:168703202-168703224 GCCCAGGGGCACCCAGGAGAAGG - Intergenic
1019146377 6:169977947-169977969 GCAGAGGGGCAGCCCACACAGGG + Intergenic
1020096076 7:5370378-5370400 GGAGAGGAGGAGCCAAGAGATGG - Exonic
1021090292 7:16474877-16474899 GCTGATGGGAATCTAAGAGAAGG + Intronic
1021778154 7:24074049-24074071 CCTGAGAGGGAGCAAAGAGAAGG - Intergenic
1023150546 7:37197699-37197721 TCTGGGGTGCAGGCAAGAGAGGG - Intronic
1023757278 7:43431554-43431576 GCTGAGGGGTGGCCCATAGATGG - Intronic
1025115143 7:56251410-56251432 GCTTCAGGGCAGCCAAGGGATGG + Intergenic
1025927042 7:65968508-65968530 GGTGAGGGGAAGCCCAGTGATGG - Intronic
1028353900 7:89883079-89883101 GCTAAGTGGCATCAAAGAGATGG - Intergenic
1029280933 7:99435075-99435097 GCCGAGGGGCAGCTGAGAGGAGG + Exonic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1030711544 7:112756045-112756067 GCAGAGTGGGATCCAAGAGAAGG + Intergenic
1031979636 7:128116378-128116400 GTTGAAGGGCAGAGAAGAGAAGG + Intergenic
1034439586 7:151079922-151079944 CCTGAGGGGCAGCCCAAAAAAGG + Exonic
1034893250 7:154858788-154858810 GCTAAGGGGCTGCCATTAGAGGG - Intronic
1035398156 7:158548496-158548518 GCTGAGGGGTCACCAAGAGCGGG - Intronic
1035472802 7:159120959-159120981 GCAGAGGGTCAGCCAGGAGGCGG - Intronic
1038454958 8:27667086-27667108 GGTGAGGGGCAGAGGAGAGAAGG - Intronic
1042422256 8:68605559-68605581 GATGAGAGGCAGCGAAGAGGAGG + Intronic
1043640370 8:82442846-82442868 GCTGAGGTGCAGCCCCGAGCAGG - Intergenic
1044083744 8:87917432-87917454 GCTGAGGGGCTGTCAAAGGAAGG - Intergenic
1044198981 8:89412566-89412588 GCTGTGGGGCAGCCACAGGATGG + Intergenic
1047801182 8:128311998-128312020 GCTCTGGGAGAGCCAAGAGATGG - Intergenic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1049569132 8:143360144-143360166 GCTGACGGGCACCCAGGAGGTGG + Intergenic
1049624655 8:143614584-143614606 GCTGAGGCCCAGCCAGGAGTCGG - Intronic
1049645929 8:143735592-143735614 GCGGAGGGGCAGGCAAGCCACGG + Intergenic
1049655901 8:143797150-143797172 GGTGAGGGGCTGCTGAGAGAGGG + Intronic
1049759158 8:144324138-144324160 GCTGTGAGGCAGGCAGGAGAGGG - Intronic
1050073966 9:1844730-1844752 GCAGAGGGACAGCCAAGATAAGG + Intergenic
1051752411 9:20356916-20356938 ACTGAGTGGCTGCCCAGAGAGGG + Intronic
1053123124 9:35560705-35560727 GCTGAGGCGCAGTCGGGAGAGGG + Exonic
1053799405 9:41754958-41754980 GCAGAGCGGCAGCCAGGACAAGG + Intergenic
1054145811 9:61560039-61560061 GCAGAGCGGCAGCCAGGACAAGG - Intergenic
1054180485 9:61905790-61905812 GCTGAGGGACACACAAGAGGGGG - Intergenic
1054465553 9:65491143-65491165 GCAGAGCGGCAGCCAGGACAAGG - Intergenic
1054472870 9:65552199-65552221 GCTGAGGGACACACAAGAGGGGG + Intergenic
1054657106 9:67675352-67675374 GCTGAGGGACACACAAGAGGGGG + Intergenic
1056115648 9:83438862-83438884 GCTGAGGTGCAGCACAGAGGTGG - Intronic
1057473744 9:95381186-95381208 GCTGAGAGGCAGCCATGGGAAGG - Intergenic
1059374654 9:113872759-113872781 AGTGTGGGGAAGCCAAGAGAAGG - Intergenic
1060537301 9:124400422-124400444 GCTGCTGGGCAGCCCAGAAAAGG - Intronic
1060796398 9:126515213-126515235 CCTGAAGGGCAGCCAGGGGAGGG - Intergenic
1060827513 9:126695384-126695406 GCTGAGGGGCGGCAAAGGCATGG - Intronic
1060926968 9:127461814-127461836 GCTTAAGGACAGCCAGGAGAAGG - Intronic
1061223538 9:129266765-129266787 GCTGAGGGTCAGGGAAGAGGAGG + Intergenic
1061860991 9:133468728-133468750 GCTGAGGCACAGCCTGGAGAGGG + Exonic
1061870762 9:133519122-133519144 GCTGAGGGGACACCGAGAGAGGG - Intronic
1061991072 9:134159089-134159111 GCAGAGGGGCAGGCAGGCGAGGG - Exonic
1062395312 9:136350403-136350425 CCTGAGGGGCACCCAAGGGGTGG + Intronic
1062454739 9:136630128-136630150 GCTGAGGGGCAGCCTGGGGCTGG - Intergenic
1062521497 9:136959781-136959803 CCTGTGGGGCAGCCCAGGGAAGG - Intergenic
1062597190 9:137304675-137304697 GCTGAGGGACATCCAAAAGGTGG + Intergenic
1187173393 X:16871731-16871753 GCTGAGGGGGTGGCTAGAGAGGG + Intergenic
1187972686 X:24674489-24674511 GATGAGGGGAAGCCACAAGAGGG - Intergenic
1192322012 X:70097508-70097530 ACTGACAGGCAGCAAAGAGAAGG + Intergenic
1200142111 X:153907543-153907565 GCTGAGGGGCAGGCAGGATGTGG + Exonic
1200249899 X:154547236-154547258 GCCGAGGGACAGCCCAGAGGAGG - Exonic
1201187121 Y:11415499-11415521 ACTGAAGGTCTGCCAAGAGATGG + Intergenic