ID: 1152638572

View in Genome Browser
Species Human (GRCh38)
Location 17:81440151-81440173
Sequence TGCCCAGAGGACAGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 219}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152638558_1152638572 27 Left 1152638558 17:81440101-81440123 CCAAACCGGTCTCCTCACCCCAC 0: 1
1: 0
2: 1
3: 19
4: 307
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638568_1152638572 2 Left 1152638568 17:81440126-81440148 CCCAGCTCCTGTGGACGGGCTCT 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638570_1152638572 -5 Left 1152638570 17:81440133-81440155 CCTGTGGACGGGCTCTGCTGCCC 0: 1
1: 0
2: 1
3: 22
4: 165
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638557_1152638572 28 Left 1152638557 17:81440100-81440122 CCCAAACCGGTCTCCTCACCCCA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638559_1152638572 22 Left 1152638559 17:81440106-81440128 CCGGTCTCCTCACCCCACACCCC 0: 1
1: 0
2: 13
3: 147
4: 1497
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638562_1152638572 10 Left 1152638562 17:81440118-81440140 CCCCACACCCCAGCTCCTGTGGA 0: 1
1: 0
2: 6
3: 43
4: 499
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638569_1152638572 1 Left 1152638569 17:81440127-81440149 CCAGCTCCTGTGGACGGGCTCTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638567_1152638572 3 Left 1152638567 17:81440125-81440147 CCCCAGCTCCTGTGGACGGGCTC 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638560_1152638572 15 Left 1152638560 17:81440113-81440135 CCTCACCCCACACCCCAGCTCCT 0: 1
1: 1
2: 30
3: 281
4: 1982
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638564_1152638572 8 Left 1152638564 17:81440120-81440142 CCACACCCCAGCTCCTGTGGACG 0: 1
1: 0
2: 0
3: 31
4: 316
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219
1152638563_1152638572 9 Left 1152638563 17:81440119-81440141 CCCACACCCCAGCTCCTGTGGAC 0: 1
1: 0
2: 2
3: 35
4: 349
Right 1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152638572 Original CRISPR TGCCCAGAGGACAGCCCCGC AGG Intronic